ECD04080 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: ECD04080

Symbol:

ECD04080

Previously known as:

RGD ID:

5507481

Expected Size:

800 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	4	43,461,202 - 43,462,003 (+)	MAPPER	mRatBN7.2
Rnor_6.0	4	41,691,549 - 41,692,348	NCBI	Rnor6.0
Rnor_5.0	4	41,278,671 - 41,279,470	UniSTS	Rnor5.0
RGSC_v3.4	4	40,730,567 - 40,731,366	UniSTS	RGSC3.4
Celera	4	38,792,722 - 38,793,521	UniSTS
Cytogenetic Map	4	q21	UniSTS

Is Marker For:

Genes: Foxp2

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	AGTTTGATTGCTGCTCATGC
Reverse Primer	TTGTCTCTGTCGCAGATTCCT

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1559697	Foxp2	forkhead box P2	4	43133827	43712442	Rat


GenBank Nucleotide	AC111321	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC128862	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2302371	Stl22	Serum triglyceride level QTL 22	5.15		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	4	5218294	57114705	Rat
2303585	Bw86	Body weight QTL 86	4		body mass (VT:0001259)	body weight (CMO:0000012)	4	14678065	59678065	Rat
1358352	Srcrt3	Stress Responsive Cort QTL 3	2.29		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	4	38465774	146803430	Rat
61445	Strs3	Sensitivity to stroke QTL 3	3		cerebrum integrity trait (VT:0010549)	post-insult time to onset of cerebrovascular lesion (CMO:0002343)	4	40433388	85433388	Rat
6893678	Bw108	Body weight QTL 108	2.6	0.006	body mass (VT:0001259)	body weight (CMO:0000012)	4	43457976	88457976	Rat
8552906	Pigfal3	Plasma insulin-like growth factor 1 level QTL 3			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	4	10084089	55084089	Rat
10755501	Bp390	Blood pressure QTL 390	2.5		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	4	26775591	168368347	Rat
8655949	Rf62	Renal function QTL 62	22		blood urea nitrogen amount (VT:0005265)	plasma urea nitrogen level (CMO:0000586)	4	34430119	44463908	Rat
1331807	Rf31	Renal function QTL 31	2.988		urine potassium amount (VT:0010539)	urine potassium level (CMO:0000128)	4	39524264	74726312	Rat
6478766	Anxrr47	Anxiety related response QTL 47		0.09637	locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	4	10084089	55084089	Rat
8552782	Vie1	Viral induced encephalitis QTL 1	26.4		brain integrity trait (VT:0010579)	encephalitis incidence/prevalence measurement (CMO:0002361)	4	34430484	82490359	Rat
631642	Stl2	Serum triglyceride level QTL 2	3.3		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	4	5219178	56647776	Rat
6478769	Anxrr48	Anxiety related response QTL 48		0.02514	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	10084089	55084089	Rat
631261	Tcas3	Tongue tumor susceptibility QTL 3	6.88		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	4	10814170	91360527	Rat
634323	Hc2	Hypercalciuria QTL 2	2.15		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	4	210796	45210796	Rat
2313401	Anxrr27	Anxiety related response QTL 27			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	4	17933508	62933508	Rat
8655961	Kidm43	Kidney mass QTL 43	18		kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	4	36303261	103194984	Rat
631209	Bw2	Body weight QTL2	4.2		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	4	9940885	44463908	Rat
6909128	Pancm4	Pancreatic morphology QTL 4	11.35		pancreas mass (VT:0010144)	pancreas wet weight (CMO:0000626)	4	26907285	75585128	Rat
8694374	Bw155	Body weight QTL 155	3.39	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	4	10084089	55084089	Rat
2303168	Bp330	Blood pressure QTL 330	4.25	0.017	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	4	5214602	146446691	Rat
8552801	Bw143	Body weight QTL 143	7.3		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	4	34430484	82490359	Rat
61475	Aia2	Adjuvant induced arthritis QTL 2	5.8		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	39505275	73892441	Rat
8694439	Bw168	Body weight QTL 168	9.57	0.001	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	4	40433414	85433414	Rat
61412	Pia2	Pristane induced arthritis QTL 2	3.9		joint integrity trait (VT:0010548)	post-insult time to onset of experimental arthritis (CMO:0001450)	4	21333343	62278020	Rat
2290374	Gluco32	Glucose level QTL 32	6.27		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	4	37177950	44463908	Rat
6478724	Anxrr35	Anxiety related response QTL 35		0.00449	defecation behavior trait (VT:0010462)	defecation measurement (CMO:0000997)	4	10084089	55084089	Rat
8655906	Rf60	Renal function QTL 60	3.8		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	4	29494195	81006281	Rat
619616	Bp79	Blood pressure QTL 79		0.0292	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	4	5214602	78882945	Rat
7387227	Uae40	Urinary albumin excretion QTL 40	2.9	0.0052	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	4	17946999	62946999	Rat
6909122	Insul22	Insulin level QTL 22	4.63		blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	4	26907285	75585128	Rat
8552809	Vie5	Viral induced encephalitis QTL 5	25.3		brain integrity trait (VT:0010579)	encephalitis incidence/prevalence measurement (CMO:0002361)	4	34430484	82490359	Rat
1358203	Stl19	Serum triglyceride level QTL 19	2.8	0.002	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	4	5218294	65958103	Rat
9590304	Scort17	Serum corticosterone level QTL 17	4.96	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	4	10084089	55084089	Rat
1300139	Hrtrt6	Heart rate QTL 6	2.85		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	4	39524264	116179656	Rat
12798520	Anxrr55	Anxiety related response QTL 55	4.45	0.01	locomotor behavior trait (VT:0001392)	number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)	4	32583980	114627242	Rat
11530004	Niddm71	Non-insulin dependent diabetes mellitus QTL 71		0.001	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	4	32584199	52754138	Rat
2316958	Gluco58	Glucose level QTL 58	10		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	4	11320076	180699135	Rat
1354665	Stl10	Serum triglyceride level QTL 10	3.57		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	4	21333343	44463908	Rat

Database	Acc Id	Source(s)
NCBI Gene	500037	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: ECD04080