UniSTS:224427 Marker Search Result

Advanced Search (OLGA)

General

Marker: UniSTS:224427

Symbol:

UniSTS:224427

Previously known as:

RGD ID:

5507083

Expected Size:

154 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	157,043,475 - 157,043,629 (+)	MAPPER	mRatBN7.2
mRatBN7.2	3	141,254,674 - 141,254,828 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	167,764,724 - 167,764,877	NCBI	Rnor6.0
Rnor_6.0	3	148,260,761 - 148,260,914	NCBI	Rnor6.0
Rnor_5.0	3	154,663,753 - 154,663,906	UniSTS	Rnor5.0
Rnor_5.0	1	173,950,156 - 173,950,309	UniSTS	Rnor5.0
RGSC_v3.4	1	160,253,751 - 160,253,904	UniSTS	RGSC3.4
RGSC_v3.4	3	143,130,254 - 143,130,407	UniSTS	RGSC3.4
Celera	3	140,004,073 - 140,004,226	UniSTS
Celera	1	155,108,572 - 155,108,725	UniSTS
Cytogenetic Map	1	q32	UniSTS
Cytogenetic Map	3	q41.2	UniSTS

Is Marker For:

Genes: Bcl2l1 Bcl2l1-ps1

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CCACACTTCTGTGAAAGCCA
Reverse Primer	TAGGGTCCCACCAACAAGAC

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1593913	Bcl2l1-ps1	Bcl2-like 1, pseudogene 1	1	157042301	157044415	Rat
2200	Bcl2l1	Bcl2-like 1	3	141253508	141304582	Rat


RefSeq Transcripts	NM_001033670	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001033671	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_003748934.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_003753341.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BC094213	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH614345.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	U72350	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	X82537	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4889419	Cstrr2	Cold stress response QTL 2		0.05	urine catecholamine amount (VT:0010502)	absolute change in urine norepinephrine level (CMO:0001634)	1	155866514	158592016	Rat
61442	Strs1	Sensitivity to stroke QTL 1	7.4		cerebrum integrity trait (VT:0010549)	post-insult time to onset of cerebrovascular lesion (CMO:0002343)	1	121767634	166767634	Rat
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
1598866	Bp287	Blood pressure QTL 287	5.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121006655	166006655	Rat
1578770	Stresp23	Stress response QTL 23			kidney sympathetic nerve activity (VT:0004050)	stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)	1	123350408	182418476	Rat
70160	Bw18	Body weight QTL 18	5.7		body mass (VT:0001259)	body weight (CMO:0000012)	1	144267353	196383668	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
631199	Cm23	Cardiac mass QTL 23	4.6	0.0004	heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	1	115585465	172949803	Rat
1354636	Lmblg1	Limb length QTL 1	6.4		tibia length (VT:0004357)	tibia length (CMO:0000450)	1	151162512	201278233	Rat
1598850	Bp297	Blood pressure QTL 297	2.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121006655	166006655	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1598853	Memor3	Memory QTL 3	4.5		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	1	143506580	212458660	Rat
1354634	Kidm12	Kidney mass QTL 12	3.9		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	1	151162512	201278233	Rat
4889428	Stresp24	Stress response QTL 24		0.05	heart pumping trait (VT:2000009)	absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)	1	155866514	200866514	Rat
152025232	Bw192	Body weight QTL 192	3.93		body mass (VT:0001259)		1	117917486	196963478	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
61343	Bp28	Blood pressure QTL 28			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	151646613	196646613	Rat
724521	Uae1	Urinary albumin excretion QTL 1	3.8	0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	90508614	173018436	Rat
1358902	Bw47	Body weight QTL 47	1.67		body mass (VT:0001259)	body weight (CMO:0000012)	1	90508614	180359386	Rat
61348	Bp30	Blood pressure QTL 30	2.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	144017057	197814409	Rat
8655649	Arrd1	Age-related retinal degeneration QTL 1	4.89		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	100357752	183970443	Rat
2303622	Vencon6	Ventilatory control QTL 6		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	1	154561505	199561505	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
731168	Bp154	Blood pressure QTL 154	3.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94642644	214537671	Rat
631202	Gluco13	Glucose level QTL 13		0.0001	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	131763437	159756369	Rat
631205	Bp196	Blood pressure QTL 196	4	0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118944897	199050459	Rat
1300158	Bp173	Blood pressure QTL 173	3.48		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	1	115540693	185145286	Rat
631206	Niddm40	Non-insulin dependent diabetes mellitus QTL 40			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	136745990	163747690	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
1331749	Hrtrt11	Heart rate QTL 11	2.973		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	94494440	198211706	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
1331751	Bp199	Blood pressure QTL 199	3.60022		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	94494440	181830018	Rat
9685799	Bp375	Blood pressure QTL 375			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	170611501	Rat
2293140	Bp313	Blood pressure QTL 313			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121833674	166833674	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
9685802	Bp376	Blood pressure QTL 376			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	126540680	171540680	Rat
1641895	Bp298	Blood pressure QTL 298			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	123350408	182418476	Rat
70209	Niddm23	Non-insulin dependent diabetes mellitus QTL 23	2.82		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	94494440	198324465	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
634315	Niddm45	Non-insulin dependent diabetes mellitus QTL 45	7.16		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	144267916	172949660	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
61379	Bp44	Blood pressure QTL 44	19.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	144267916	174133260	Rat
1331793	Bp200	Blood pressure QTL 200	3.71601		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94494440	172949803	Rat
2313060	Bss71	Bone structure and strength QTL 71	2.6	0.0001	long bone metaphysis morphology trait (VT:0000133)	tibia midshaft total cross-sectional area (CMO:0001715)	1	118944747	163944747	Rat
2312420	Pur17	Proteinuria QTL 17	7.1	0.0001	urine protein amount (VT:0005160)	urine total protein excretion rate (CMO:0000756)	1	156677124	218753816	Rat
6893347	Bw98	Body weight QTL 98	0.2	0.53	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
1354591	Cm36	Cardiac mass QTL 36	4.1		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	102813953	201278233	Rat
724550	Thym3	Thymus enlargement QTL 3	7.82	0.001	thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	136829932	181829932	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
71118	Thym1	Thymus enlargement QTL 1	10.17	0.001	thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	136829932	181829932	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
631519	Pia11	Pristane induced arthritis QTL 11	5.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	136830018	181830018	Rat
6893361	Bw104	Body weight QTL 104	0.59	0.27	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
738006	Anxrr14	Anxiety related response QTL 14	4	0.00035	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	130636910	175636910	Rat
1558645	Bw55	Body weight QTL 55	3.2	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
1354615	Cm32	Cardiac mass QTL 32	5.2		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	1	102813953	201278233	Rat
1582204	Livw1	Liver weight QTL 1	3.6	0.0003	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	1	155422851	172949803	Rat
634348	Bp138	Blood pressure QTL 138			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	168883176	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
738028	Anxrr12	Anxiety related response QTL 12	4.9	0.00001	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	130636910	175636910	Rat
1354620	Kidm19	Kidney mass QTL 19	4		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	201278233	Rat
8693608	Alc24	Alcohol consumption QTL 24	2.3	0.74	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	150452391	168228760	Rat
1354618	Kidm15	Kidney mass QTL 15	5		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	1	156677124	201278233	Rat
631654	Bp107	Blood pressure QTL 107			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	170611501	Rat
631544	Bp84	Blood pressure QTL 84	5.6		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	123350408	181759564	Rat
152025212	Bw190	Body weight QTL 190	5.7		body mass (VT:0001259)		1	123556856	196963478	Rat
631549	Bp89	Blood pressure QTL 89	5.7		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	123350581	201284552	Rat
631548	Bp88	Blood pressure QTL 88	5	0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	156677124	176484451	Rat
1358189	Cstrr1	Cold stress response QTL 1		0.0001	catecholamine amount (VT:0010543)	urine norepinephrine level (CMO:0001629)	1	123350408	182418476	Rat
1354606	Bp246	Blood pressure QTL 246	3.6		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	102813953	218753816	Rat
1354602	Bw35	Body weight QTL 35	12.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	201278233	Rat
4889419	Cstrr2	Cold stress response QTL 2		0.05	urine catecholamine amount (VT:0010502)	absolute change in urine norepinephrine level (CMO:0001634)	1	155866514	158592016	Rat
61442	Strs1	Sensitivity to stroke QTL 1	7.4		cerebrum integrity trait (VT:0010549)	post-insult time to onset of cerebrovascular lesion (CMO:0002343)	1	121767634	166767634	Rat
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
1578770	Stresp23	Stress response QTL 23			kidney sympathetic nerve activity (VT:0004050)	stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)	1	123350408	182418476	Rat
70160	Bw18	Body weight QTL 18	5.7		body mass (VT:0001259)	body weight (CMO:0000012)	1	144267353	196383668	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
1581568	Rf53	Renal function QTL 53			urine total protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	3	56395968	161299569	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
1578754	Stresp16	Stress response QTL 16	4	0.001	blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	3	112681431	157681431	Rat
4889428	Stresp24	Stress response QTL 24		0.05	heart pumping trait (VT:2000009)	absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)	1	155866514	200866514	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
10755461	Coatc16	Coat color QTL 16			coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	3	122438700	167438700	Rat
724521	Uae1	Urinary albumin excretion QTL 1	3.8	0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	90508614	173018436	Rat
1358902	Bw47	Body weight QTL 47	1.67		body mass (VT:0001259)	body weight (CMO:0000012)	1	90508614	180359386	Rat
631841	Niddm39	Non-insulin dependent diabetes mellitus QTL 39	3.36		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	3	94856903	159898684	Rat
731168	Bp154	Blood pressure QTL 154	3.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94642644	214537671	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
2301971	Cm71	Cardiac mass QTL 71	4.63		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	3	41874578	155617519	Rat
1331749	Hrtrt11	Heart rate QTL 11	2.973		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	94494440	198211706	Rat
2301970	Bw81	Body weight QTL 81	5.19		body mass (VT:0001259)	body weight (CMO:0000012)	3	41874578	155617519	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
1331751	Bp199	Blood pressure QTL 199	3.60022		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	94494440	181830018	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
70209	Niddm23	Non-insulin dependent diabetes mellitus QTL 23	2.82		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	94494440	198324465	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
1331793	Bp200	Blood pressure QTL 200	3.71601		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94494440	172949803	Rat
2313060	Bss71	Bone structure and strength QTL 71	2.6	0.0001	long bone metaphysis morphology trait (VT:0000133)	tibia midshaft total cross-sectional area (CMO:0001715)	1	118944747	163944747	Rat
70216	Cm14	Cardiac mass QTL 14	2.1		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	3	31172320	163586636	Rat
6893347	Bw98	Body weight QTL 98	0.2	0.53	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
1354591	Cm36	Cardiac mass QTL 36	4.1		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	102813953	201278233	Rat
724550	Thym3	Thymus enlargement QTL 3	7.82	0.001	thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	136829932	181829932	Rat
2292591	Esta4	Estrogen-induced thymic atrophy QTL 4			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	3	47233211	147415807	Rat
2298477	Eau4	Experimental allergic uveoretinitis QTL 4		0.0011	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	3	137398739	169034231	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
6893361	Bw104	Body weight QTL 104	0.59	0.27	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
1558645	Bw55	Body weight QTL 55	3.2	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	1	133680936	178680936	Rat
1354615	Cm32	Cardiac mass QTL 32	5.2		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	1	102813953	201278233	Rat
1582204	Livw1	Liver weight QTL 1	3.6	0.0003	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	1	155422851	172949803	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1354611	Despr2	Despair related QTL 2	3.03	0.0028	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	3	97084464	142084464	Rat
1354620	Kidm19	Kidney mass QTL 19	4		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	201278233	Rat
1576306	Schws3	Schwannoma susceptibility QTL 3		0.001	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	3	118839124	163839124	Rat
619618	Rf3	Renal disease susceptibility QTL 3	6.5	0.001	urine albumin amount (VT:0002871)	urine albumin excretion rate to body weight ratio (CMO:0001270)	3	107693393	152693393	Rat
5686842	Rf59	Renal function QTL 59			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	3	140069424	146976080	Rat
1354618	Kidm15	Kidney mass QTL 15	5		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	1	156677124	201278233	Rat
631654	Bp107	Blood pressure QTL 107			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	170611501	Rat
631673	Iddm13	Insulin dependent diabetes mellitus QTL 13	1.3	0.663	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	3	130193298	161695983	Rat
152025212	Bw190	Body weight QTL 190	5.7		body mass (VT:0001259)		1	123556856	196963478	Rat
1358189	Cstrr1	Cold stress response QTL 1		0.0001	catecholamine amount (VT:0010543)	urine norepinephrine level (CMO:0001629)	1	123350408	182418476	Rat
1354606	Bp246	Blood pressure QTL 246	3.6		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	102813953	218753816	Rat
8552952	Pigfal13	Plasma insulin-like growth factor 1 level QTL 13			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	3	138799500	169034231	Rat
2293087	Iddm27	Insulin dependent diabetes mellitus QTL 27	2.68		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	3	97551417	147415807	Rat
1354602	Bw35	Body weight QTL 35	12.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	201278233	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1598877	Bp285	Blood pressure QTL 285	1.5	0.03	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	120538241	165538241	Rat
1578653	Vnigr3	Vascular neointimal growth QTL 3	3.1		artery morphology trait (VT:0002191)	artery neointimal hyperplastic lesion area (CMO:0001414)	3	130656562	169034231	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
2302373	Gluco39	Glucose level QTL 39	5.01		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	3	98535386	161695835	Rat
1298068	Bp167	Blood pressure QTL 167		0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	141074471	169034231	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
1598866	Bp287	Blood pressure QTL 287	5.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121006655	166006655	Rat
631199	Cm23	Cardiac mass QTL 23	4.6	0.0004	heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	1	115585465	172949803	Rat
1354636	Lmblg1	Limb length QTL 1	6.4		tibia length (VT:0004357)	tibia length (CMO:0000450)	1	151162512	201278233	Rat
1598850	Bp297	Blood pressure QTL 297	2.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121006655	166006655	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1598853	Memor3	Memory QTL 3	4.5		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	1	143506580	212458660	Rat
1354634	Kidm12	Kidney mass QTL 12	3.9		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	1	151162512	201278233	Rat
152025232	Bw192	Body weight QTL 192	3.93		body mass (VT:0001259)		1	117917486	196963478	Rat
61343	Bp28	Blood pressure QTL 28			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	151646613	196646613	Rat
61348	Bp30	Blood pressure QTL 30	2.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	144017057	197814409	Rat
8662816	Vetf4	Vascular elastic tissue fragility QTL 4	4		renal artery integrity trait (VT:0010642)	number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)	3	59242096	157323038	Rat
8655649	Arrd1	Age-related retinal degeneration QTL 1	4.89		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	100357752	183970443	Rat
2303622	Vencon6	Ventilatory control QTL 6		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	1	154561505	199561505	Rat
2303620	Vencon4	Ventilatory control QTL 4	3.9		respiration trait (VT:0001943)	tidal volume (CMO:0000222)	3	127162703	168026850	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
631202	Gluco13	Glucose level QTL 13		0.0001	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	131763437	159756369	Rat
631205	Bp196	Blood pressure QTL 196	4	0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118944897	199050459	Rat
1300159	Kidm4	Kidney mass QTL 4	3.83		kidney mass (VT:0002707)	right kidney wet weight to body weight ratio (CMO:0001953)	3	121056165	157309487	Rat
1300158	Bp173	Blood pressure QTL 173	3.48		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	1	115540693	185145286	Rat
631206	Niddm40	Non-insulin dependent diabetes mellitus QTL 40			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	136745990	163747690	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
9685799	Bp375	Blood pressure QTL 375			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	170611501	Rat
2293140	Bp313	Blood pressure QTL 313			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	121833674	166833674	Rat
1578656	Vnigr2	Vascular neointimal growth QTL 2	4.2		artery morphology trait (VT:0002191)	lesioned artery residual lumen area (CMO:0001417)	3	130656562	169034231	Rat
9685802	Bp376	Blood pressure QTL 376			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	126540680	171540680	Rat
1641895	Bp298	Blood pressure QTL 298			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	123350408	182418476	Rat
634315	Niddm45	Non-insulin dependent diabetes mellitus QTL 45	7.16		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	144267916	172949660	Rat
2312673	Scl63	Serum cholesterol level QTL 63		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	3	98535255	168026850	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
61379	Bp44	Blood pressure QTL 44	19.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	144267916	174133260	Rat
2312420	Pur17	Proteinuria QTL 17	7.1	0.0001	urine protein amount (VT:0005160)	urine total protein excretion rate (CMO:0000756)	1	156677124	218753816	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
71118	Thym1	Thymus enlargement QTL 1	10.17	0.001	thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	136829932	181829932	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
631519	Pia11	Pristane induced arthritis QTL 11	5.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	136830018	181830018	Rat
738006	Anxrr14	Anxiety related response QTL 14	4	0.00035	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	130636910	175636910	Rat
1300173	Rf11	Renal function QTL 11	3.38		renal blood flow trait (VT:2000006)	absolute change in renal blood flow rate (CMO:0001168)	3	121056165	145956249	Rat
9589106	Insul23	Insulin level QTL 23	13.86	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	3	131635904	169034231	Rat
634348	Bp138	Blood pressure QTL 138			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	125611501	168883176	Rat
1559282	Emca5	Estrogen-induced mammary cancer QTL 5	3.9		mammary gland integrity trait (VT:0010552)	percentage of study population developing mammary tumors during a period of time (CMO:0000948)	3	43827364	169034231	Rat
738028	Anxrr12	Anxiety related response QTL 12	4.9	0.00001	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	130636910	175636910	Rat
8693608	Alc24	Alcohol consumption QTL 24	2.3	0.74	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	150452391	168228760	Rat
2312659	Slep7	Serum leptin concentration QTL 7		0.001	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	3	98535255	168026850	Rat
631544	Bp84	Blood pressure QTL 84	5.6		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	123350408	181759564	Rat
1581546	Pur13	Proteinuria QTL 13	2.93	0.0335	urine total protein amount (VT:0000032)	urine protein excretion rate (CMO:0000759)	3	78196190	146592722	Rat
631549	Bp89	Blood pressure QTL 89	5.7		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	123350581	201284552	Rat
631548	Bp88	Blood pressure QTL 88	5	0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	156677124	176484451	Rat
631541	Bp81	Blood pressure QTL 81	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	124122556	169034231	Rat
2312670	Bw94	Body weight QTL 94		0.01	inguinal fat pad mass (VT:0010424)	inguinal fat pad weight to body weight ratio (CMO:0001253)	3	98535255	168026850	Rat

Database	Acc Id	Source(s)
NCBI Gene	24888	UniSTS
	293190	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: UniSTS:224427