AU049006 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AU049006

Symbol: AU049006
Previously known as:
RGD ID: 5089185
Expected Size: 113 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21816,380,535 - 16,380,590 (+)MAPPERmRatBN7.2
mRatBN7.21816,380,535 - 16,380,650 (+)MAPPERmRatBN7.2
Rnor_6.01817,286,853 - 17,286,965NCBIRnor6.0
Rnor_6.01817,286,853 - 17,286,907NCBIRnor6.0
Rnor_5.01817,041,321 - 17,041,433UniSTSRnor5.0
Rnor_5.01817,041,321 - 17,041,375UniSTSRnor5.0
RGSC_v3.41816,906,441 - 16,906,495UniSTSRGSC3.4
RGSC_v3.41816,906,441 - 16,906,553UniSTSRGSC3.4
Celera1816,291,389 - 16,291,501UniSTS
Celera1816,291,389 - 16,291,443UniSTS
Cytogenetic Map18p12UniSTS
Is Marker For: Genes:   Fhod3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCCGCCAATAATAAAACAC
Reverse Primer TGGTATGTGTGTGTGTGTGTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2322319Fhod3formin homology 2 domain containing 3181599307916425796Rat

Nucleotide Sequences
GenBank Nucleotide AU049006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301410Bp317Blood pressure QTL 3170.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194427326548295Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
8552968Pigfal19Plasma insulin-like growth factor 1 level QTL 1911.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)18125758124Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
1331781Scl28Serum cholesterol level QTL 283.995blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)181194429924797117Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
12904680Bw189Body weight QTL 1890.019body mass (VT:0001259)body weight (CMO:0000012)181194427326548295Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)18224947722066430Rat
12904693Am20Aortic mass QTL 200.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)181194427326548295Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
12904695Kidm73Kidney mass QTL 730.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)181194427326548295Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
12904689Cm128Cardiac mass QTL 1280.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)181194427326548295Rat
12904690Cm129Cardiac mass QTL 1290.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)181194427326548295Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
12904691Cm130Cardiac mass QTL 1300.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)181194427326548295Rat
9590248Scort10Serum corticosterone level QTL 1019.710.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)18125758124Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360334 UniSTS