AU029143 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU029143

Symbol: AU029143
Previously known as:
RGD ID: 5069748
Expected Size: 129 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81421,595,169 - 21,595,298 (+)Marker Load Pipeline
mRatBN7.21421,240,334 - 21,240,463 (+)MAPPERmRatBN7.2
Rnor_6.01423,026,914 - 23,027,042NCBIRnor6.0
Rnor_5.01422,924,197 - 22,924,325UniSTSRnor5.0
RGSC_v3.41422,859,997 - 22,860,125UniSTSRGSC3.4
Celera1420,733,414 - 20,733,542UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTTCAAGACTGCAGAAACTG
Reverse Primer GATCCCTACCTCATATCA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU029143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618060.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631528Scl11Serum cholesterol level QTL 114.9blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)141787564536079022Rat
7411573Bw139Body weight QTL 1394.70.001body mass (VT:0001259)body weight gain (CMO:0000420)14140068101Rat
9589814Gluco67Glucose level QTL 674.540.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14140068101Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14939329839411170Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141133490630674469Rat
2302277Gluco38Glucose level QTL 385.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141133471628389666Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14395787831121464Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14862139853621398Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)141891545442433608Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14395787824886169Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1411334716100078267Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141889519263895192Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141790672654251504Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141415516Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14131893212Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14862139853621398Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141513759431238250Rat


Additional Information