D7Got69 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Got69

Symbol: D7Got69
Previously known as: oxsts570; OT85.03; 
RGD ID: 44277
Expected Size: 206 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2788,787,933 - 88,788,139 (+)MAPPERmRatBN7.2
Rnor_6.0797,109,715 - 97,109,920NCBIRnor6.0
Rnor_5.0797,725,496 - 97,725,701UniSTSRnor5.0
RGSC_v3.4793,932,544 - 93,932,751RGDRGSC3.4
RGSC_v3.4793,932,546 - 93,932,751UniSTSRGSC3.4
RGSC_v3.1793,966,774 - 93,966,981RGD
Celera785,565,077 - 85,565,282UniSTS
RH 3.4 Map7606.1UniSTS
RH 3.4 Map7606.1RGD
RH 2.0 Map7507.8RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer TTGGCTTCTGAAGTCACTGCT
Reverse Primer ACAGTGAGATCACACACAGAGACAC
 
GenBank Nucleotide AU028196 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 43 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat

1 to 10 of 43 rows