D7Got26 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Got26

Symbol: D7Got26
Previously known as: oxsts562; OT32.01; 
RGD ID: 44240
Expected Size: 292 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2732,104,823 - 32,105,115 (+)MAPPERmRatBN7.2
Rnor_6.0738,567,337 - 38,567,628NCBIRnor6.0
Rnor_5.0738,608,785 - 38,609,076UniSTSRnor5.0
RGSC_v3.4734,808,412 - 34,808,704RGDRGSC3.4
RGSC_v3.4734,808,413 - 34,808,704UniSTSRGSC3.4
RGSC_v3.1734,828,683 - 34,828,975RGD
Celera729,142,815 - 29,143,106UniSTS
RH 3.4 Map7252.1UniSTS
RH 3.4 Map7252.1RGD
RH 2.0 Map7222.7RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GCTTTCTCTCCGGACATTTCT
Reverse Primer TCTTAAGAATCAAAGGGCTGG
 
GenBank Nucleotide AU028193 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 31 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1354644Spl4Serum phospholipid level QTL 44.9blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)71965431749753746Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72192119566921195Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)72409960669099606Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat

1 to 10 of 31 rows