Symbol:
Nphs2
Name:
NPHS2 stomatin family member, podocin
RGD ID:
620461
Description:
Predicted to be involved in actin cytoskeleton organization and metanephric podocyte development. Predicted to act upstream of or within gene expression. Predicted to be located in cytoplasmic side of plasma membrane; membrane raft; and slit diaphragm. Predicted to be part of protein-containing complex. Predicted to be active in plasma membrane. Used to study membranous glomerulonephritis and proteinuria. Biomarker of nephrotic syndrome. Human ortholog(s) of this gene implicated in nephrotic syndrome type 2. Orthologous to human NPHS2 (NPHS2 stomatin family member, podocin); INTERACTS WITH 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine; acrylamide; all-trans-retinoic acid.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
MGC112589; nephrosis 2 homolog (human); nephrosis 2 homolog, podocin; nephrosis 2 homolog, podocin (human); nephrosis 2 idiopathic steroid-resistant (podocin); nephrosis 2, idiopathic, steroid-resistant; nephrosis 2, idiopathic, steroid-resistant (podocin); NPHS2, podocin; podocin
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
NPHS2 (NPHS2 stomatin family member, podocin) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Nphs2 (nephrosis 2, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Nphs2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
NPHS2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
NPHS2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Nphs2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
NPHS2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
NPHS2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Nphs2 (NPHS2 stomatin family member, podocin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Nphs2 (nephrosis 2, podocin)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
NPHS2 (NPHS2 stomatin family member, podocin)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
nphs2 (NPHS2 stomatin family member, podocin)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 70,993,622 - 71,011,585 (+) NCBI GRCr8 mRatBN7.2 13 68,448,720 - 68,461,312 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 68,448,926 - 68,461,313 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 71,027,985 - 71,040,345 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 72,348,422 - 72,360,808 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 69,609,908 - 69,622,294 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 73,929,136 - 73,941,522 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 73,929,136 - 73,941,522 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 78,853,114 - 78,865,500 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 71,296,482 - 71,308,868 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 71,310,669 - 71,323,056 (+) NCBI Celera 13 68,309,838 - 68,322,218 (+) NCBI Celera Cytogenetic Map 13 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Nphs2 Rat 1,1-dichloroethene decreases expression ISO Nphs2 (Mus musculus) 6480464 vinylidene chloride results in decreased expression of NPHS2 mRNA CTD PMID:26682919 Nphs2 Rat 17alpha-ethynylestradiol multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of NPHS2 mRNA CTD PMID:17942748 Nphs2 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of NPHS2 mRNA CTD PMID:17942748 Nphs2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine decreases expression ISO Nphs2 (Mus musculus) 6480464 Puromycin Aminonucleoside results in decreased expression of NPHS2 protein CTD PMID:18509322 Nphs2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine decreases expression EXP 6480464 Puromycin Aminonucleoside results in decreased expression of NPHS2 protein CTD PMID:12065681 and PMID:18509322 Nphs2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine multiple interactions EXP 6480464 triptolide inhibits the reaction [Puromycin Aminonucleoside results in decreased expression of NPHS2 protein] CTD PMID:18509322 Nphs2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine multiple interactions ISO Nphs2 (Mus musculus) 6480464 triptolide inhibits the reaction [Puromycin Aminonucleoside results in decreased expression of NPHS2 protein] CTD PMID:18509322 Nphs2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine affects expression EXP 6480464 Puromycin Aminonucleoside affects the expression of NPHS2 mRNA and Puromycin Aminonucleoside affects the expression of NPHS2 protein CTD PMID:15363039 Nphs2 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of NPHS2 mRNA CTD PMID:28628672 Nphs2 Rat 4,4'-sulfonyldiphenol multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of NPHS2 mRNA CTD PMID:28628672 Nphs2 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of NPHS2 mRNA CTD PMID:28959563 Nphs2 Rat aflatoxin B1 increases expression ISO NPHS2 (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of NPHS2 mRNA CTD PMID:21641981 Nphs2 Rat aflatoxin B1 decreases methylation ISO NPHS2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of NPHS2 gene and Aflatoxin B1 results in decreased methylation of NPHS2 intron CTD PMID:27153756 and PMID:30157460 Nphs2 Rat all-trans-retinoic acid increases expression ISO Nphs2 (Mus musculus) 6480464 Tretinoin results in increased expression of NPHS2 protein CTD PMID:15954902 Nphs2 Rat all-trans-retinoic acid multiple interactions EXP 6480464 Tretinoin inhibits the reaction [Doxorubicin results in increased expression of NPHS2 mRNA] CTD PMID:16636307 Nphs2 Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of NPHS2 protein CTD PMID:15954902 Nphs2 Rat AM6545 multiple interactions ISO Nphs2 (Mus musculus) 6480464 AM6545 inhibits the reaction [Streptozocin results in decreased expression of NPHS2 mRNA] more ... CTD PMID:30184259 Nphs2 Rat amitriptyline multiple interactions ISO Nphs2 (Mus musculus) 6480464 Amitriptyline inhibits the reaction [Homocysteine results in decreased expression of NPHS2 protein] CTD PMID:23024785 Nphs2 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of NPHS2 mRNA CTD PMID:16483693 Nphs2 Rat apocynin multiple interactions ISO Nphs2 (Mus musculus) 6480464 acetovanillone inhibits the reaction [Homocysteine results in decreased expression of NPHS2 mRNA] and acetovanillone inhibits the reaction [Homocysteine results in decreased expression of NPHS2 protein] CTD PMID:20036696 Nphs2 Rat aristolochic acid A multiple interactions EXP 6480464 [aristolochic acid I co-treated with aristolochic acid II] results in decreased expression of NPHS2 mRNA CTD PMID:23912714 Nphs2 Rat arsenous acid increases expression ISO NPHS2 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of NPHS2 mRNA CTD PMID:20458559 Nphs2 Rat bacitracin decreases expression EXP 6480464 Bacitracin results in decreased expression of NPHS2 mRNA CTD PMID:18289764 Nphs2 Rat benzo[a]pyrene increases methylation ISO NPHS2 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of NPHS2 exon CTD PMID:27901495 Nphs2 Rat benzo[a]pyrene affects methylation ISO NPHS2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of NPHS2 promoter CTD PMID:27901495 Nphs2 Rat bisphenol A decreases expression ISO Nphs2 (Mus musculus) 6480464 bisphenol A results in decreased expression of NPHS2 protein CTD PMID:24809654 Nphs2 Rat bisphenol A decreases expression ISO NPHS2 (Homo sapiens) 6480464 bisphenol A results in decreased expression of NPHS2 protein CTD PMID:33024228 Nphs2 Rat bisphenol A multiple interactions ISO NPHS2 (Homo sapiens) 6480464 Tamoxifen inhibits the reaction [bisphenol A results in decreased expression of NPHS2 protein] CTD PMID:33024228 Nphs2 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of NPHS2 gene CTD PMID:28505145 Nphs2 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of NPHS2 mRNA CTD PMID:25181051 Nphs2 Rat caffeine decreases expression EXP 6480464 Caffeine results in decreased expression of NPHS2 mRNA CTD PMID:25986755 and PMID:31306741 Nphs2 Rat CGP 52608 multiple interactions ISO NPHS2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to NPHS2 gene] CTD PMID:28238834 Nphs2 Rat chloroprene decreases expression ISO Nphs2 (Mus musculus) 6480464 Chloroprene results in decreased expression of NPHS2 mRNA CTD PMID:23125180 Nphs2 Rat copper(II) sulfate increases expression ISO NPHS2 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of NPHS2 mRNA CTD PMID:19549813 Nphs2 Rat cyclosporin A multiple interactions ISO Nphs2 (Mus musculus) 6480464 Cyclosporine results in decreased expression of and results in increased secretion of NPHS2 protein CTD PMID:21354196 Nphs2 Rat Deoxycorticosterone acetate multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Desoxycorticosterone Acetate co-treated with Sodium Chloride] affects the localization of [NPHS2 protein co-treated with CDH3 protein] more ... CTD PMID:21992601 Nphs2 Rat dexamethasone multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of NPHS2 mRNA CTD PMID:28628672 Nphs2 Rat dexamethasone multiple interactions EXP 6480464 AGTR2 protein inhibits the reaction [Dexamethasone results in decreased expression of NPHS2 mRNA] and Mifepristone inhibits the reaction [Dexamethasone results in decreased expression of NPHS2 mRNA] CTD PMID:30359671 Nphs2 Rat dexamethasone decreases expression EXP 6480464 Dexamethasone results in decreased expression of NPHS2 mRNA CTD PMID:30359671 Nphs2 Rat diarsenic trioxide increases expression ISO NPHS2 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of NPHS2 mRNA CTD PMID:20458559 Nphs2 Rat dibenziodolium multiple interactions ISO Nphs2 (Mus musculus) 6480464 diphenyleneiodonium inhibits the reaction [Homocysteine results in decreased expression of NPHS2 mRNA] and diphenyleneiodonium inhibits the reaction [Homocysteine results in decreased expression of NPHS2 protein] CTD PMID:20036696 Nphs2 Rat doxorubicin decreases expression ISO Nphs2 (Mus musculus) 6480464 Doxorubicin results in decreased expression of NPHS2 mRNA and Doxorubicin results in decreased expression of NPHS2 protein CTD PMID:19073829 more ... Nphs2 Rat doxorubicin multiple interactions ISO Nphs2 (Mus musculus) 6480464 2 more ... CTD PMID:29064158 Nphs2 Rat doxorubicin multiple interactions EXP 6480464 Drugs more ... CTD PMID:16636307 and PMID:21354902 Nphs2 Rat doxorubicin increases expression EXP 6480464 Doxorubicin results in increased expression of NPHS2 mRNA and Doxorubicin results in increased expression of NPHS2 protein CTD PMID:16636307 Nphs2 Rat doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of NPHS2 mRNA and Doxorubicin results in decreased expression of NPHS2 protein CTD PMID:16636307 and PMID:21354902 Nphs2 Rat ergosta-4,6,8(14),22-tetraen-3-one multiple interactions ISO NPHS2 (Homo sapiens) 6480464 ergosta-4 more ... CTD PMID:28578904 Nphs2 Rat ethanol affects expression ISO Nphs2 (Mus musculus) 6480464 Ethanol affects the expression of NPHS2 mRNA CTD PMID:30319688 Nphs2 Rat filipin III multiple interactions ISO Nphs2 (Mus musculus) 6480464 Filipin inhibits the reaction [Homocysteine results in decreased expression of NPHS2 mRNA] and Filipin inhibits the reaction [Homocysteine results in decreased expression of NPHS2 protein] CTD PMID:20036696 Nphs2 Rat folic acid decreases expression ISO Nphs2 (Mus musculus) 6480464 Folic Acid deficiency results in decreased expression of NPHS2 protein CTD PMID:21647593 and PMID:21893018 Nphs2 Rat folic acid multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Folic Acid deficiency results in increased abundance of Homocysteine] which results in decreased expression of NPHS2 mRNA more ... CTD PMID:20116427 and PMID:21647593 Nphs2 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of NPHS2 mRNA CTD PMID:18289764 Nphs2 Rat graphite affects expression EXP 6480464 Graphite affects the expression of NPHS2 mRNA CTD PMID:29933104 Nphs2 Rat homocysteine multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Folic Acid deficiency results in increased abundance of Homocysteine] which results in decreased expression of NPHS2 mRNA more ... CTD PMID:20036696 more ... Nphs2 Rat homocysteine decreases expression ISO Nphs2 (Mus musculus) 6480464 Homocysteine results in decreased expression of NPHS2 mRNA and Homocysteine results in decreased expression of NPHS2 protein CTD PMID:20036696 and PMID:23024785 Nphs2 Rat indometacin multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of NPHS2 mRNA CTD PMID:28628672 Nphs2 Rat lisinopril dihydrate multiple interactions EXP 6480464 Lisinopril affects the reaction [Doxorubicin results in increased expression of NPHS2 mRNA] and Lisinopril affects the reaction [Doxorubicin results in increased expression of NPHS2 protein] CTD PMID:16636307 Nphs2 Rat losartan multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [Losartan co-treated with ICG 001] inhibits the reaction [AGT protein results in decreased expression of NPHS2 protein] CTD PMID:28578904 Nphs2 Rat methyl beta-cyclodextrin multiple interactions ISO Nphs2 (Mus musculus) 6480464 methyl-beta-cyclodextrin inhibits the reaction [Homocysteine results in decreased expression of NPHS2 mRNA] and methyl-beta-cyclodextrin inhibits the reaction [Homocysteine results in decreased expression of NPHS2 protein] CTD PMID:20036696 Nphs2 Rat mifepristone multiple interactions EXP 6480464 Mifepristone inhibits the reaction [Dexamethasone results in decreased expression of NPHS2 mRNA] CTD PMID:30359671 Nphs2 Rat Nandrolone decanoate increases expression EXP 6480464 nandrolone decanoate results in increased expression of NPHS2 mRNA CTD PMID:29097219 Nphs2 Rat Pachymic acid multiple interactions ISO NPHS2 (Homo sapiens) 6480464 pachymic acid analog inhibits the reaction [AGT protein results in decreased expression of NPHS2 protein] CTD PMID:28578904 Nphs2 Rat paraquat increases expression ISO Nphs2 (Mus musculus) 6480464 Paraquat results in increased expression of NPHS2 protein CTD PMID:26988026 Nphs2 Rat perindopril multiple interactions ISO Nphs2 (Mus musculus) 6480464 AM6545 promotes the reaction [Perindopril inhibits the reaction [Streptozocin results in decreased expression of NPHS2 mRNA]] more ... CTD PMID:30184259 Nphs2 Rat pirinixic acid multiple interactions ISO NPHS2 (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of NPHS2 mRNA CTD PMID:19710929 Nphs2 Rat prednisone multiple interactions EXP 6480464 Prednisone inhibits the reaction [Doxorubicin results in increased expression of NPHS2 mRNA] CTD PMID:16636307 Nphs2 Rat procyanidin B2 multiple interactions EXP 6480464 procyanidin B2 inhibits the reaction [Streptozocin results in increased expression of NPHS2 mRNA] and procyanidin B2 inhibits the reaction [Streptozocin results in increased expression of NPHS2 protein] CTD PMID:25199697 Nphs2 Rat resveratrol multiple interactions EXP 6480464 resveratrol inhibits the reaction [Dietary Fats results in decreased expression of NPHS2 protein] CTD PMID:25025298 Nphs2 Rat silicon dioxide increases expression ISO NPHS2 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of NPHS2 mRNA and Silicon Dioxide results in increased expression of NPHS2 mRNA CTD PMID:25895662 and PMID:34973136 Nphs2 Rat simvastatin increases expression ISO NPHS2 (Homo sapiens) 6480464 Simvastatin results in increased expression of NPHS2 mRNA CTD PMID:16710349 Nphs2 Rat sirolimus affects expression EXP 6480464 Sirolimus affects the expression of NPHS2 protein CTD PMID:19671594 Nphs2 Rat sodium arsenite increases expression ISO Nphs2 (Mus musculus) 6480464 sodium arsenite results in increased expression of NPHS2 mRNA CTD PMID:37682722 Nphs2 Rat sodium chloride multiple interactions ISO Nphs2 (Mus musculus) 6480464 [Desoxycorticosterone Acetate co-treated with Sodium Chloride] affects the localization of [NPHS2 protein co-treated with CDH3 protein] more ... CTD PMID:21992601 Nphs2 Rat spironolactone increases expression EXP 6480464 Spironolactone results in increased expression of NPHS2 protein CTD PMID:30734886 Nphs2 Rat streptozocin multiple interactions EXP 6480464 Drugs more ... CTD PMID:20547220 and PMID:25199697 Nphs2 Rat streptozocin decreases expression ISO Nphs2 (Mus musculus) 6480464 Streptozocin results in decreased expression of NPHS2 mRNA and Streptozocin results in decreased expression of NPHS2 protein CTD PMID:30184259 Nphs2 Rat streptozocin multiple interactions ISO Nphs2 (Mus musculus) 6480464 AM6545 inhibits the reaction [Streptozocin results in decreased expression of NPHS2 mRNA] more ... CTD PMID:30184259 Nphs2 Rat streptozocin decreases expression EXP 6480464 Streptozocin results in decreased expression of NPHS2 mRNA and Streptozocin results in decreased expression of NPHS2 protein CTD PMID:20547220 and PMID:25199697 Nphs2 Rat tamoxifen multiple interactions ISO NPHS2 (Homo sapiens) 6480464 Tamoxifen inhibits the reaction [bisphenol A results in decreased expression of NPHS2 protein] CTD PMID:33024228 Nphs2 Rat tebuconazole decreases expression ISO NPHS2 (Homo sapiens) 6480464 tebuconazole results in decreased expression of NPHS2 mRNA CTD PMID:30458266 Nphs2 Rat titanium dioxide decreases expression ISO Nphs2 (Mus musculus) 6480464 titanium dioxide results in decreased expression of NPHS2 mRNA CTD PMID:29264374 Nphs2 Rat Triptolide multiple interactions ISO Nphs2 (Mus musculus) 6480464 triptolide inhibits the reaction [Puromycin Aminonucleoside results in decreased expression of NPHS2 protein] CTD PMID:18509322 Nphs2 Rat Triptolide multiple interactions EXP 6480464 triptolide inhibits the reaction [Puromycin Aminonucleoside results in decreased expression of NPHS2 protein] CTD PMID:18509322 Nphs2 Rat triptonide increases expression ISO Nphs2 (Mus musculus) 6480464 triptonide results in increased expression of NPHS2 mRNA CTD PMID:33045310 Nphs2 Rat vancomycin increases expression ISO Nphs2 (Mus musculus) 6480464 Vancomycin results in increased expression of NPHS2 mRNA CTD PMID:18930951
1,1-dichloroethene (ISO) 17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (EXP,ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) acrylamide (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP,ISO) AM6545 (ISO) amitriptyline (ISO) ammonium chloride (EXP) apocynin (ISO) aristolochic acid A (EXP) arsenous acid (ISO) bacitracin (EXP) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) caffeine (EXP) CGP 52608 (ISO) chloroprene (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) Deoxycorticosterone acetate (ISO) dexamethasone (EXP,ISO) diarsenic trioxide (ISO) dibenziodolium (ISO) doxorubicin (EXP,ISO) ergosta-4,6,8(14),22-tetraen-3-one (ISO) ethanol (ISO) filipin III (ISO) folic acid (ISO) gentamycin (EXP) graphite (EXP) homocysteine (ISO) indometacin (ISO) lisinopril dihydrate (EXP) losartan (ISO) methyl beta-cyclodextrin (ISO) mifepristone (EXP) Nandrolone decanoate (EXP) Pachymic acid (ISO) paraquat (ISO) perindopril (ISO) pirinixic acid (ISO) prednisone (EXP) procyanidin B2 (EXP) resveratrol (EXP) silicon dioxide (ISO) simvastatin (ISO) sirolimus (EXP) sodium arsenite (ISO) sodium chloride (ISO) spironolactone (EXP) streptozocin (EXP,ISO) tamoxifen (ISO) tebuconazole (ISO) titanium dioxide (ISO) Triptolide (EXP,ISO) triptonide (ISO) vancomycin (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
3.
Cloning of rat homologue of podocin: expression in proteinuric states and in developing glomeruli.
Kawachi H, etal., J Am Soc Nephrol 2003 Jan;14(1):46-56.
4.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
5.
Nephrin and podocin dissociate at the onset of proteinuria in experimental membranous nephropathy.
Nakatsue T, etal., Kidney Int. 2005 Jun;67(6):2239-53.
6.
Glomerular abundance of nephrin and podocin in experimental nephrotic syndrome: different effects of antiproteinuric therapies.
Nakhoul F, etal., Am J Physiol Renal Physiol. 2005 Oct;289(4):F880-90. Epub 2005 Jun 7.
7.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
8.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
9.
Online Mendelian Inheritance in Man, OMIM (TM).
Online Mendelian Inheritance in Man, OMIM (TM).
10.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
11.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
12.
Comprehensive gene review and curation
RGD comprehensive gene curation
13.
Involvement of renal corpuscle microRNA expression on epithelial-to-mesenchymal transition in maternal low protein diet in adult programmed rats.
Sene Lde B, etal., PLoS One. 2013 Aug 19;8(8):e71310. doi: 10.1371/journal.pone.0071310. eCollection 2013.
Nphs2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 70,993,622 - 71,011,585 (+) NCBI GRCr8 mRatBN7.2 13 68,448,720 - 68,461,312 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 68,448,926 - 68,461,313 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 71,027,985 - 71,040,345 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 72,348,422 - 72,360,808 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 69,609,908 - 69,622,294 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 73,929,136 - 73,941,522 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 73,929,136 - 73,941,522 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 78,853,114 - 78,865,500 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 71,296,482 - 71,308,868 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 71,310,669 - 71,323,056 (+) NCBI Celera 13 68,309,838 - 68,322,218 (+) NCBI Celera Cytogenetic Map 13 q22 NCBI
NPHS2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 179,550,539 - 179,575,948 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 179,550,539 - 179,575,952 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 179,519,674 - 179,545,083 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 177,786,299 - 177,811,691 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 176,251,332 - 176,276,725 NCBI Celera 1 152,627,305 - 152,652,723 (-) NCBI Celera Cytogenetic Map 1 q25.2 NCBI HuRef 1 150,746,292 - 150,771,710 (-) NCBI HuRef CHM1_1 1 180,943,494 - 180,968,904 (-) NCBI CHM1_1 T2T-CHM13v2.0 1 178,905,541 - 178,930,958 (-) NCBI T2T-CHM13v2.0
Nphs2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 156,138,105 - 156,155,605 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 156,138,297 - 156,155,605 (+) Ensembl GRCm39 Ensembl GRCm38 1 156,310,535 - 156,328,035 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 156,310,727 - 156,328,035 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 158,240,866 - 158,258,166 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 158,147,412 - 158,164,712 (+) NCBI MGSCv36 mm8 Celera 1 158,706,623 - 158,724,043 (+) NCBI Celera Cytogenetic Map 1 G3 NCBI cM Map 1 67.71 NCBI
Nphs2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955406 18,863,446 - 18,885,279 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955406 18,862,054 - 18,885,214 (-) NCBI ChiLan1.0 ChiLan1.0
NPHS2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 70,184,353 - 70,209,779 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 69,842,636 - 69,868,081 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 155,038,753 - 155,064,332 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3
NPHS2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 20,347,526 - 20,375,975 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 20,354,134 - 20,374,020 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 19,880,091 - 19,899,246 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 20,091,600 - 20,110,548 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 20,091,036 - 20,110,222 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 20,000,474 - 20,019,613 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 20,106,845 - 20,127,281 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 20,242,370 - 20,261,517 (+) NCBI UU_Cfam_GSD_1.0
Nphs2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 91,649,128 - 91,669,416 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936481 9,496,127 - 9,515,534 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936481 9,496,083 - 9,516,086 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NPHS2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 121,218,369 - 121,236,430 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 121,217,734 - 121,236,214 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 133,034,063 - 133,052,590 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
NPHS2
Nphs2
.
Predicted Target Of
Count of predictions: 86 Count of miRNA genes: 37 Interacting mature miRNAs: 41 Transcripts: ENSRNOT00000005425, ENSRNOT00000041107 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1298066 Bp159 Blood pressure QTL 159 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 46088046 91088046 Rat 10755495 Bp387 Blood pressure QTL 387 3.78 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34663461 87525369 Rat 1354655 Bp241 Blood pressure QTL 241 3.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 56056920 101056920 Rat 70220 Bp55 Blood pressure QTL 55 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 71119 Thym2 Thymus enlargement QTL 2 3.8 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 13 46197976 84753113 Rat 4889861 Pur29 Proteinuria QTL 29 13.8 0.005 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 13 37415584 80753406 Rat 12879441 Bp396 Blood pressure QTL 396 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 45699983 90699983 Rat 2293687 Bss26 Bone structure and strength QTL 26 4.6 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 13 65103704 106807694 Rat 619615 Bp80 Blood pressure QTL 80 0.0354 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 39754544 84754544 Rat 2303028 Bp329 Blood pressure QTL 329 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 58497872 73485113 Rat 1581570 Eae17 Experimental allergic encephalomyelitis QTL 17 4.1 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 8897350 101631289 Rat 61340 Bp25 Blood pressure QTL 25 4.2 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34535218 79535218 Rat 1581573 Uae36 Urinary albumin excretion QTL 36 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 1549897 Stresp12 Stress response QTL 12 3.35 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 13 38433408 83433408 Rat 724564 Uae11 Urinary albumin excretion QTL 11 5.7 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 13 59492522 77046890 Rat 7207885 Glom27 Glomerulus QTL 27 3.9 kidney glomerulus integrity trait (VT:0010546) kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139) 13 20605871 101339738 Rat 7387280 Uae43 Urinary albumin excretion QTL 43 5.69 0.4174 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 66451204 106807694 Rat 738026 Lnnr5 Liver neoplastic nodule remodeling QTL 5 3.29 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number (CMO:0001461) 13 59874408 85581182 Rat 1558644 Cm45 Cardiac mass QTL 45 3.6 0.002 heart mass (VT:0007028) heart wet weight (CMO:0000069) 13 23692969 68692969 Rat 70181 BpQTLcluster11 Blood pressure QTL cluster 11 6.922 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 13 31241331 93395974 Rat 2293702 Bss34 Bone structure and strength QTL 34 4.61 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 13 65103704 106807694 Rat 61349 Bp31 Blood pressure QTL 31 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 2303563 Bw89 Body weight QTL 89 6 body mass (VT:0001259) body weight (CMO:0000012) 13 32284471 77284471 Rat 1354621 Rf47 Renal function QTL 47 3.7 kidney renin amount (VT:0010559) kidney renin level (CMO:0002166) 13 30395351 101056920 Rat 1581554 Pur11 Proteinuria QTL 11 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 12879477 Bp401 Blood pressure QTL 401 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 37262092 82262092 Rat 1331750 Bp220 Blood pressure QTL 220 2.98 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 13 37415584 82415584 Rat 6893338 Cm76 Cardiac mass QTL 76 0 0.99 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 13 23692969 68692969 Rat 1641901 Alcrsp6 Alcohol response QTL 6 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 13 52362171 97362171 Rat 12879475 Bp400 Blood pressure QTL 400 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 61825626 106807694 Rat 1354666 Bp244 Blood pressure QTL 244 4.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 1 101056920 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
45
108
65
64
33
25
33
6
188
93
88
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000005425 ⟹ ENSRNOP00000005425
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,448,929 - 68,461,313 (+) Ensembl Rnor_6.0 Ensembl 13 73,929,136 - 73,941,522 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000094869 ⟹ ENSRNOP00000088544
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,448,926 - 68,461,118 (+) Ensembl
RefSeq Acc Id:
NM_130828 ⟹ NP_570841
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,999,186 - 71,011,572 (+) NCBI mRatBN7.2 13 68,448,926 - 68,461,312 (+) NCBI Rnor_6.0 13 73,929,136 - 73,941,522 (+) NCBI Rnor_5.0 13 78,853,114 - 78,865,500 (+) NCBI RGSC_v3.4 13 71,296,482 - 71,308,868 (+) RGD Celera 13 68,309,838 - 68,322,218 (+) RGD
Sequence:
AGAAAATTGGGGCTGCGACTCTGCCAGCATCTGGCTTTGGGGGGCGTGCCCGCCGCGTAGAATGGACAGCAGGGCGCGGAGCTCTTCCAGAAAGACCCACGGGAGAGGTAGCAGGTCCTCTTCTAGGG
hide sequence
RefSeq Acc Id:
XM_039090291 ⟹ XP_038946219
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,993,622 - 71,011,585 (+) NCBI mRatBN7.2 13 68,448,720 - 68,461,196 (+) NCBI
RefSeq Acc Id:
NP_570841 ⟸ NM_130828
- UniProtKB:
Q8K4G9 (UniProtKB/Swiss-Prot), Q8CJE4 (UniProtKB/Swiss-Prot), Q80WP2 (UniProtKB/Swiss-Prot), Q4G090 (UniProtKB/Swiss-Prot), Q920E2 (UniProtKB/Swiss-Prot), A6ID08 (UniProtKB/TrEMBL)
- Sequence:
MDSRARSSSRKTHGRGSRSSSRDDKKSKAGRGNRGRARPDAGVERQSAGRMGTREEHRAPAATVVNVDEVRSPGEEGRKVVALLESERPEEGIKPSGLGACEWLLVLSSLIFIIVTFPFSIWFCIKVV
hide sequence
Ensembl Acc Id:
ENSRNOP00000005425 ⟸ ENSRNOT00000005425
RefSeq Acc Id:
XP_038946219 ⟸ XM_039090291
- Peptide Label:
isoform X1
- UniProtKB:
A6ID09 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000088544 ⟸ ENSRNOT00000094869
RGD ID: 13698914 Promoter ID: EPDNEW_R9439 Type: single initiation site Name: Nphs2_1 Description: NPHS2, podocin SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 13 73,929,136 - 73,929,196 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-04-04
Nphs2
NPHS2 stomatin family member, podocin
Nphs2
NPHS2, podocin
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2017-02-01
Nphs2
NPHS2, podocin
Nphs2
nephrosis 2, idiopathic, steroid-resistant
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2011-07-06
Nphs2
nephrosis 2, idiopathic, steroid-resistant
Nphs2
nephrosis 2 homolog (human)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2009-11-06
Nphs2
nephrosis 2 homolog (human)
Nphs2
nephrosis 2 homolog, podocin (human)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-12-14
Nphs2
nephrosis 2 homolog, podocin (human)
nephrosis 2, idiopathic, steroid-resistant (podocin)
Name updated
1299863 APPROVED
2002-08-07
Nphs2
nephrosis 2, idiopathic, steroid-resistant (podocin)
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_disease
human homolog is mutated in autosomal recessive steroid resistant nephrotic syndrome
724395
gene_expression
expressed in renal glomeruli and nerve tissues
724395
