Symbol:
Nub1
Name:
negative regulator of ubiquitin-like proteins 1
RGD ID:
1359489
Description:
Predicted to be involved in several processes, including positive regulation of proteasomal ubiquitin-dependent protein catabolic process; response to tumor necrosis factor; and response to type II interferon. Predicted to act upstream of or within proteasomal protein catabolic process. Predicted to be located in Lewy body; cytosol; and nuclear lumen. Orthologous to human NUB1 (negative regulator of ubiquitin like proteins 1); PARTICIPATES IN neddylation pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; 4,4'-sulfonyldiphenol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
BS4; NEDD8 ultimate buster 1; NEDD8 ultimate buster-1; NY-REN-18 antigen; NYREN18
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 11,335,376 - 11,366,263 (-) NCBI GRCr8 mRatBN7.2 4 10,442,917 - 10,473,689 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 10,442,917 - 10,473,694 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 15,589,502 - 15,619,758 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 11,409,700 - 11,439,956 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 9,761,499 - 9,791,741 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 6,950,870 - 6,981,400 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 6,951,478 - 6,978,073 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 6,964,480 - 6,994,708 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 5,820,488 - 5,850,809 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 5,820,488 - 5,850,809 (-) NCBI Celera 4 6,058,478 - 6,088,841 (-) NCBI Celera Cytogenetic Map 4 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Nub1 Rat 1,10-phenanthroline increases expression ISO NUB1 (Homo sapiens) 6480464 1 and 10-phenanthroline results in increased expression of NUB1 mRNA CTD PMID:19502547 Nub1 Rat 1,2-dimethylhydrazine increases expression ISO Nub1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of NUB1 mRNA CTD PMID:22206623 Nub1 Rat 1,2-dimethylhydrazine multiple interactions ISO Nub1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of NUB1 mRNA CTD PMID:22206623 Nub1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Nub1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of NUB1 mRNA CTD PMID:21570461 Nub1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of NUB1 mRNA CTD PMID:33387578 Nub1 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of NUB1 mRNA CTD PMID:21346803 Nub1 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of NUB1 mRNA CTD PMID:36041667 Nub1 Rat 5-aza-2'-deoxycytidine affects expression ISO NUB1 (Homo sapiens) 6480464 Decitabine affects the expression of NUB1 mRNA CTD PMID:23300844 Nub1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of NUB1 mRNA CTD PMID:24780913 and PMID:30047161 Nub1 Rat acrolein multiple interactions ISO NUB1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of NUB1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of NUB1 mRNA CTD PMID:32699268 Nub1 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of NUB1 mRNA CTD PMID:28959563 Nub1 Rat all-trans-retinoic acid increases expression ISO NUB1 (Homo sapiens) 6480464 Tretinoin results in increased expression of NUB1 mRNA CTD PMID:21934132 Nub1 Rat alpha-pinene multiple interactions ISO NUB1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of NUB1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of NUB1 mRNA CTD PMID:32699268 Nub1 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of NUB1 mRNA CTD PMID:30047161 Nub1 Rat antirheumatic drug decreases expression ISO NUB1 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of NUB1 mRNA CTD PMID:24449571 Nub1 Rat arsane affects methylation ISO NUB1 (Homo sapiens) 6480464 Arsenic affects the methylation of NUB1 gene CTD PMID:25304211 Nub1 Rat arsenic atom affects methylation ISO NUB1 (Homo sapiens) 6480464 Arsenic affects the methylation of NUB1 gene CTD PMID:25304211 Nub1 Rat avobenzone increases expression ISO NUB1 (Homo sapiens) 6480464 avobenzone results in increased expression of NUB1 mRNA CTD PMID:31016361 Nub1 Rat benzo[a]pyrene increases expression ISO Nub1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of NUB1 mRNA CTD PMID:21715664 Nub1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Nub1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of NUB1 mRNA CTD PMID:33754040 Nub1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of NUB1 mRNA CTD PMID:25181051 Nub1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of NUB1 mRNA CTD PMID:36041667 Nub1 Rat bisphenol A increases methylation ISO NUB1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of NUB1 gene CTD PMID:31601247 Nub1 Rat bisphenol A decreases expression ISO Nub1 (Mus musculus) 6480464 bisphenol A results in decreased expression of NUB1 mRNA CTD PMID:33221593 Nub1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of NUB1 mRNA CTD PMID:30816183 more ... Nub1 Rat bisphenol F increases expression ISO Nub1 (Mus musculus) 6480464 bisphenol F results in increased expression of NUB1 mRNA CTD PMID:38685157 Nub1 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of NUB1 mRNA CTD PMID:36041667 Nub1 Rat bortezomib increases expression ISO NUB1 (Homo sapiens) 6480464 Bortezomib results in increased expression of NUB1 mRNA CTD PMID:20977926 Nub1 Rat carbon nanotube decreases expression ISO Nub1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Nub1 Rat CGP 52608 multiple interactions ISO NUB1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to NUB1 gene] CTD PMID:28238834 Nub1 Rat cisplatin affects expression ISO NUB1 (Homo sapiens) 6480464 Cisplatin affects the expression of NUB1 mRNA CTD PMID:23300844 Nub1 Rat copper(II) sulfate decreases expression ISO NUB1 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of NUB1 mRNA CTD PMID:19549813 Nub1 Rat cyclosporin A increases expression ISO NUB1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of NUB1 mRNA CTD PMID:27989131 Nub1 Rat diethylstilbestrol increases expression ISO NUB1 (Homo sapiens) 6480464 Diethylstilbestrol results in increased expression of NUB1 mRNA CTD PMID:36621641 Nub1 Rat enzyme inhibitor multiple interactions ISO NUB1 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of NUB1 protein CTD PMID:23301498 Nub1 Rat epoxiconazole decreases expression ISO Nub1 (Mus musculus) 6480464 epoxiconazole results in decreased expression of NUB1 mRNA CTD PMID:35436446 Nub1 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of NUB1 mRNA CTD PMID:24136188 Nub1 Rat folic acid multiple interactions ISO Nub1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of NUB1 mRNA CTD PMID:22206623 Nub1 Rat formaldehyde increases expression ISO NUB1 (Homo sapiens) 6480464 Formaldehyde results in increased expression of NUB1 mRNA CTD PMID:23649840 Nub1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of NUB1 mRNA CTD PMID:33387578 Nub1 Rat ketoconazole increases expression ISO NUB1 (Homo sapiens) 6480464 Ketoconazole results in increased expression of NUB1 mRNA CTD PMID:36621641 Nub1 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of NUB1 mRNA CTD PMID:30047161 Nub1 Rat nickel atom increases expression ISO NUB1 (Homo sapiens) 6480464 Nickel results in increased expression of NUB1 mRNA CTD PMID:24768652 and PMID:25583101 Nub1 Rat nickel sulfate increases expression ISO NUB1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of NUB1 mRNA CTD PMID:16780908 Nub1 Rat ozone multiple interactions ISO NUB1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of NUB1 mRNA more ... CTD PMID:32699268 Nub1 Rat paracetamol decreases expression ISO NUB1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of NUB1 mRNA CTD PMID:21420995 Nub1 Rat phenobarbital decreases expression EXP 6480464 Phenobarbital results in decreased expression of NUB1 mRNA CTD PMID:30047161 Nub1 Rat sodium arsenite decreases expression ISO NUB1 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of NUB1 mRNA CTD PMID:28595984 Nub1 Rat Soman decreases expression EXP 6480464 Soman results in decreased expression of NUB1 mRNA CTD PMID:19281266 Nub1 Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of NUB1 mRNA CTD PMID:30047161 Nub1 Rat thimerosal decreases expression ISO NUB1 (Homo sapiens) 6480464 Thimerosal results in decreased expression of NUB1 mRNA CTD PMID:27188386 Nub1 Rat thiram decreases expression ISO NUB1 (Homo sapiens) 6480464 Thiram results in decreased expression of NUB1 mRNA CTD PMID:38568856 Nub1 Rat titanium dioxide decreases methylation ISO Nub1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of NUB1 gene CTD PMID:35295148 Nub1 Rat trichostatin A affects expression ISO NUB1 (Homo sapiens) 6480464 trichostatin A affects the expression of NUB1 mRNA CTD PMID:28542535 Nub1 Rat triphenyl phosphate affects expression ISO NUB1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of NUB1 mRNA CTD PMID:37042841 Nub1 Rat tungsten decreases expression ISO Nub1 (Mus musculus) 6480464 Tungsten results in decreased expression of NUB1 mRNA CTD PMID:30912803 Nub1 Rat vorinostat decreases expression ISO NUB1 (Homo sapiens) 6480464 vorinostat results in decreased expression of NUB1 mRNA CTD PMID:27188386 Nub1 Rat zidovudine multiple interactions ISO NUB1 (Homo sapiens) 6480464 [Zidovudine co-treated with IFNA1 protein] results in increased expression of NUB1 mRNA CTD PMID:20370541
1,10-phenanthroline (ISO) 1,2-dimethylhydrazine (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dinitrotoluene (EXP) 4,4'-sulfonyldiphenol (EXP) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) acrolein (ISO) acrylamide (EXP) all-trans-retinoic acid (ISO) alpha-pinene (ISO) amitrole (EXP) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) avobenzone (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (EXP,ISO) bortezomib (ISO) carbon nanotube (ISO) CGP 52608 (ISO) cisplatin (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) diethylstilbestrol (ISO) enzyme inhibitor (ISO) epoxiconazole (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) gentamycin (EXP) ketoconazole (ISO) methimazole (EXP) nickel atom (ISO) nickel sulfate (ISO) ozone (ISO) paracetamol (ISO) phenobarbital (EXP) sodium arsenite (ISO) Soman (EXP) sulfadimethoxine (EXP) thimerosal (ISO) thiram (ISO) titanium dioxide (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) tungsten (ISO) vorinostat (ISO) zidovudine (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
NUB1, a NEDD8-interacting protein, is induced by interferon and down-regulates the NEDD8 expression.
Kito K, etal., J Biol Chem 2001 Jun 8;276(23):20603-9. Epub 2001 Mar 19.
3.
Regulation of cullin-based ubiquitin ligases by the Nedd8/RUB ubiquitin-like proteins.
Parry G and Estelle M, Semin Cell Dev Biol. 2004 Apr;15(2):221-9.
4.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
5.
Comprehensive gene review and curation
RGD comprehensive gene curation
6.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
Nub1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 11,335,376 - 11,366,263 (-) NCBI GRCr8 mRatBN7.2 4 10,442,917 - 10,473,689 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 10,442,917 - 10,473,694 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 15,589,502 - 15,619,758 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 11,409,700 - 11,439,956 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 9,761,499 - 9,791,741 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 6,950,870 - 6,981,400 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 6,951,478 - 6,978,073 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 6,964,480 - 6,994,708 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 5,820,488 - 5,850,809 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 5,820,488 - 5,850,809 (-) NCBI Celera 4 6,058,478 - 6,088,841 (-) NCBI Celera Cytogenetic Map 4 q11 NCBI
NUB1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 151,341,812 - 151,378,449 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 151,341,772 - 151,378,449 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 151,038,898 - 151,075,535 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 150,669,791 - 150,706,468 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 7 145,596,247 - 145,632,781 (+) NCBI Celera Cytogenetic Map 7 q36.1 NCBI HuRef 7 144,850,514 - 144,887,070 (+) NCBI HuRef CHM1_1 7 151,047,250 - 151,083,821 (+) NCBI CHM1_1 T2T-CHM13v2.0 7 152,514,799 - 152,551,295 (+) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 150,368,354 - 150,404,911 (+) NCBI
Nub1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 24,890,813 - 24,915,376 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 24,890,530 - 24,915,376 (+) Ensembl GRCm39 Ensembl GRCm38 5 24,685,815 - 24,710,378 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 24,685,532 - 24,710,378 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 24,191,633 - 24,216,373 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 24,196,041 - 24,220,443 (+) NCBI MGSCv36 mm8 Celera 5 21,642,444 - 21,667,264 (+) NCBI Celera Cytogenetic Map 5 A3 NCBI cM Map 5 11.93 NCBI
Nub1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955491 5,709,791 - 5,739,079 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955491 5,709,791 - 5,737,620 (+) NCBI ChiLan1.0 ChiLan1.0
NUB1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 187,762,530 - 187,799,621 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 39,772,796 - 39,809,887 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 142,927,730 - 142,964,475 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 155,079,171 - 155,115,913 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 7 155,079,243 - 155,114,676 (+) Ensembl panpan1.1 panPan2
NUB1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 16 15,355,237 - 15,382,284 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 16 15,352,476 - 15,381,095 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 16 15,962,876 - 15,989,492 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 16 17,077,383 - 17,104,127 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 17,075,097 - 17,104,127 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 16 15,449,341 - 15,475,957 (+) NCBI UMICH_Zoey_3.1
Nub1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 6,146,984 - 6,177,063 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936527 6,726,357 - 6,755,318 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936527 6,726,363 - 6,756,445 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NUB1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 18 5,899,568 - 5,928,884 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 18 5,899,566 - 5,928,981 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 18 6,247,107 - 6,274,794 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
NUB1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 21 119,525,757 - 119,559,412 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 21 119,525,932 - 119,560,886 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666072 15,496,939 - 15,530,260 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Nub1
.
Predicted Target Of
Count of predictions: 76 Count of miRNA genes: 65 Interacting mature miRNAs: 70 Transcripts: ENSRNOT00000045311 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
2302371 Stl22 Serum triglyceride level QTL 22 5.15 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 57114705 Rat 8552903 Pigfal2 Plasma insulin-like growth factor 1 level QTL 2 7.3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 4 1 31934116 Rat 724557 Plsm1 Polydactyly-luxate syndrome (PLS) morphotypes QTL 1 0.0003 forelimb integrity trait (VT:0010562) front foot phalanges count (CMO:0001947) 4 1 27716890 Rat 9590100 Sffal4 Serum free fatty acids level QTL 4 7.36 0.05 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 4 1 31934116 Rat 8552906 Pigfal3 Plasma insulin-like growth factor 1 level QTL 3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 4 10084089 55084089 Rat 1357341 Gluco5 Glucose level QTL 5 6.4 adipocyte free fatty acid secretion trait (VT:0010465) absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446) 4 1 33250345 Rat 1357343 Gluco4 Glucose level QTL 4 0.00002 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874) 4 1 33250345 Rat 6478766 Anxrr47 Anxiety related response QTL 47 0.09637 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 10084089 55084089 Rat 631642 Stl2 Serum triglyceride level QTL 2 3.3 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5219178 56647776 Rat 6478769 Anxrr48 Anxiety related response QTL 48 0.02514 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 10084089 55084089 Rat 61333 Gluco16 Glucose level QTL 16 4.3 0.00001 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 1 30372989 Rat 634323 Hc2 Hypercalciuria QTL 2 2.15 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 4 210796 45210796 Rat 61408 Scl23 Serum cholesterol level QTL 23 0.0005 blood HDL phospholipid amount (VT:0010504) serum high density lipoprotein phospholipid level (CMO:0001567) 4 1 27716890 Rat 631209 Bw2 Body weight QTL2 4.2 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 4 9940885 44463908 Rat 8694374 Bw155 Body weight QTL 155 3.39 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 4 10084089 55084089 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 9589046 Scfw2 Subcutaneous fat weight QTL 2 5.54 0.001 subcutaneous adipose mass (VT:1000472) abdominal subcutaneous fat pad weight (CMO:0002069) 4 1 31934116 Rat 6478724 Anxrr35 Anxiety related response QTL 35 0.00449 defecation behavior trait (VT:0010462) defecation measurement (CMO:0000997) 4 10084089 55084089 Rat 61351 Bp33 Blood pressure QTL 33 0.0018 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 1 27716890 Rat 61415 Eae11 Experimental allergic encephalomyelitis QTL 11 2.9 nervous system integrity trait (VT:0010566) post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422) 4 1 39505420 Rat 1641905 Colcr1 Colorectal carcinoma resistance QTL 1 4.3 0.0003 intestine integrity trait (VT:0010554) benign colorectal tumor surface area measurement (CMO:0001799) 4 1 29494328 Rat 619616 Bp79 Blood pressure QTL 79 0.0292 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 5214602 78882945 Rat 1358201 Gluco12 Glucose level QTL12 1.6 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake (CMO:0000870) 4 5218392 29593287 Rat 738021 Hcar13 Hepatocarcinoma resistance QTL 13 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 4 1 32584199 Rat 1358203 Stl19 Serum triglyceride level QTL 19 2.8 0.002 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 65958103 Rat 9590304 Scort17 Serum corticosterone level QTL 17 4.96 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 10084089 55084089 Rat 9589097 Slep11 Serum leptin concentration QTL 11 5.09 0.001 blood leptin amount (VT:0005667) plasma leptin level (CMO:0000781) 4 1 31934116 Rat 1300141 Bp178 Blood pressure QTL 178 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 10024901 39524530 Rat
D4Rat144
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 10,495,201 - 10,495,445 (+) MAPPER mRatBN7.2 Rnor_6.0 4 7,023,217 - 7,023,460 NCBI Rnor6.0 Rnor_5.0 4 7,035,728 - 7,035,971 UniSTS Rnor5.0 RGSC_v3.4 4 5,874,672 - 5,874,916 RGD RGSC3.4 RGSC_v3.4 4 5,874,673 - 5,874,916 UniSTS RGSC3.4 RGSC_v3.1 4 5,874,588 - 5,874,945 RGD Celera 4 6,111,278 - 6,111,521 UniSTS SHRSP x BN Map 4 0.0 UniSTS SHRSP x BN Map 4 0.0 RGD Cytogenetic Map 4 q11 UniSTS
D4Got11
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 11,340,159 - 11,340,265 (+) Marker Load Pipeline mRatBN7.2 4 10,447,700 - 10,447,806 (+) MAPPER mRatBN7.2 Rnor_6.0 4 6,955,148 - 6,955,253 NCBI Rnor6.0 Rnor_5.0 4 6,968,758 - 6,968,863 UniSTS Rnor5.0 RGSC_v3.4 4 5,825,098 - 5,825,203 UniSTS RGSC3.4 RGSC_v3.4 4 5,825,097 - 5,825,203 RGD RGSC3.4 RGSC_v3.4 4 5,824,765 - 5,824,871 RGD RGSC3.4 RGSC_v3.4 4 5,824,766 - 5,824,871 UniSTS RGSC3.4 RGSC_v3.1 4 5,825,098 - 5,825,203 RGD RH 3.4 Map 4 14.0 RGD RH 3.4 Map 4 14.0 UniSTS RH 2.0 Map 4 63.2 RGD Cytogenetic Map 4 q11 UniSTS
RH128463
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 10,443,019 - 10,443,209 (+) MAPPER mRatBN7.2 Rnor_6.0 4 6,950,467 - 6,950,656 NCBI Rnor6.0 Rnor_5.0 4 6,964,077 - 6,964,266 UniSTS Rnor5.0 RGSC_v3.4 4 5,820,085 - 5,820,274 UniSTS RGSC3.4 Celera 4 6,058,075 - 6,058,264 UniSTS Cytogenetic Map 4 q11 UniSTS
RH128761
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 10,443,580 - 10,443,766 (+) MAPPER mRatBN7.2 Rnor_6.0 4 6,951,028 - 6,951,213 NCBI Rnor6.0 Rnor_5.0 4 6,964,638 - 6,964,823 UniSTS Rnor5.0 RGSC_v3.4 4 5,820,646 - 5,820,831 UniSTS RGSC3.4 Celera 4 6,058,636 - 6,058,821 UniSTS Cytogenetic Map 4 q11 UniSTS
RH138616
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 10,448,936 - 10,449,117 (+) MAPPER mRatBN7.2 Rnor_6.0 4 6,956,381 - 6,956,561 NCBI Rnor6.0 Rnor_5.0 4 6,969,991 - 6,970,171 UniSTS Rnor5.0 RGSC_v3.4 4 5,826,331 - 5,826,511 UniSTS RGSC3.4 Celera 4 6,064,102 - 6,064,282 UniSTS Cytogenetic Map 4 q11 UniSTS
RH139609
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 10,443,184 - 10,443,376 (+) MAPPER mRatBN7.2 Rnor_6.0 4 6,950,632 - 6,950,823 NCBI Rnor6.0 Rnor_5.0 4 6,964,242 - 6,964,433 UniSTS Rnor5.0 RGSC_v3.4 4 5,820,250 - 5,820,441 UniSTS RGSC3.4 Celera 4 6,058,240 - 6,058,431 UniSTS Cytogenetic Map 4 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000045311 ⟹ ENSRNOP00000048314
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 10,444,031 - 10,473,694 (-) Ensembl Rnor_6.0 Ensembl 4 6,951,478 - 6,978,073 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000098051 ⟹ ENSRNOP00000086699
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 10,442,917 - 10,471,056 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000108045 ⟹ ENSRNOP00000078815
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 10,442,919 - 10,470,461 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000115102 ⟹ ENSRNOP00000076727
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 10,442,917 - 10,472,315 (-) Ensembl
RefSeq Acc Id:
NM_001013925 ⟹ NP_001013947
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 11,335,882 - 11,366,146 (-) NCBI mRatBN7.2 4 10,443,423 - 10,473,689 (-) NCBI Rnor_6.0 4 6,950,870 - 6,981,400 (-) NCBI Rnor_5.0 4 6,964,480 - 6,994,708 (-) NCBI RGSC_v3.4 4 5,820,488 - 5,850,809 (-) RGD Celera 4 6,058,478 - 6,088,841 (-) RGD
Sequence:
CACCCGGAATGAAAACAAACGGCGGCCTCTGCCGCATCCGGGCATTTGGCTGGTCTCGGCTGGCTCGGTGGTGGCGCAGTTTTACTTTCAAGGATGGCGCAGAAGAAATATCTTCAAGCAAAACTGAC
hide sequence
RefSeq Acc Id:
XM_039107214 ⟹ XP_038963142
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 11,335,376 - 11,366,263 (-) NCBI mRatBN7.2 4 10,442,917 - 10,473,681 (-) NCBI
RefSeq Acc Id:
XM_039107215 ⟹ XP_038963143
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 11,335,376 - 11,355,597 (-) NCBI mRatBN7.2 4 10,442,917 - 10,463,139 (-) NCBI
RefSeq Acc Id:
XM_063285691 ⟹ XP_063141761
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 11,335,376 - 11,366,065 (-) NCBI
RefSeq Acc Id:
NP_001013947 ⟸ NM_001013925
- UniProtKB:
Q5XIT4 (UniProtKB/TrEMBL), A0A8I6A4A9 (UniProtKB/TrEMBL)
- Sequence:
MAQKKYLQAKLTQFLREDRIQLWKPPYTEENKEVGLALKDLAKRYSERLECCENEVENIIEEIRCKAIERGTGNEHYRTTGIATIEVFLPPRLRKDKKSLLETRLHVTGRDLRSKIAETFGFQENYIK
hide sequence
Ensembl Acc Id:
ENSRNOP00000048314 ⟸ ENSRNOT00000045311
RefSeq Acc Id:
XP_038963142 ⟸ XM_039107214
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6A4A9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963143 ⟸ XM_039107215
- Peptide Label:
isoform X3
Ensembl Acc Id:
ENSRNOP00000078815 ⟸ ENSRNOT00000108045
Ensembl Acc Id:
ENSRNOP00000086699 ⟸ ENSRNOT00000098051
Ensembl Acc Id:
ENSRNOP00000076727 ⟸ ENSRNOT00000115102
RefSeq Acc Id:
XP_063141761 ⟸ XM_063285691
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I6A4A9 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-06
Nub1
negative regulator of ubiquitin-like proteins 1
Nub1
NEDD8 ultimate buster-1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-07-29
Nub1
NEDD8 ultimate buster-1
Symbol and Name status set to provisional
70820 PROVISIONAL
