Symbol:
Rragd
Name:
Ras-related GTP binding D
RGD ID:
1310007
Description:
Predicted to enable several functions, including GTPase binding activity; guanyl ribonucleotide binding activity; and protein heterodimerization activity. Predicted to be involved in several processes, including cellular response to L-leucine; cellular response to leucine starvation; and positive regulation of TORC1 signaling. Predicted to be located in centrosome; cytoplasm; and nucleoplasm. Predicted to be part of Gtr1-Gtr2 GTPase complex. Predicted to be active in lysosome and nucleus. Human ortholog(s) of this gene implicated in renal hypomagnesemia 7, with or without dilated cardiomyopathy. Orthologous to human RRAGD (Ras related GTP binding D); PARTICIPATES IN mTOR signaling pathway; INTERACTS WITH 1-(3-(trifluoromethyl)phenyl)piperazine; 1-benzylpiperazine; 17beta-estradiol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC297960; ras-related GTP-binding protein D
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
RRAGD (Ras related GTP binding D) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther
Mus musculus (house mouse):
Rragd (Ras-related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Rragd (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
RRAGD (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
RRAGD (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Rragd (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
RRAGD (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
RRAGD (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Rragd (Ras related GTP binding D) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
RRAGD (Ras related GTP binding D)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Rragd (Ras-related GTP binding D)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
rragd (ras-related GTP binding D)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
GTR2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
RagC-D
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
ragc-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
rragd
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 52,170,234 - 52,205,700 (+) NCBI GRCr8 mRatBN7.2 5 47,373,902 - 47,409,369 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 47,373,463 - 47,409,356 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 49,519,454 - 49,555,330 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 51,118,640 - 51,154,514 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 51,061,448 - 51,097,777 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 48,224,994 - 48,260,691 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 48,224,994 - 48,260,685 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 52,808,853 - 52,844,550 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 49,269,195 - 49,304,824 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 49,269,463 - 49,304,853 (+) NCBI Celera 5 46,131,676 - 46,167,177 (+) NCBI Celera Cytogenetic Map 5 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rragd Rat 1-(3-(trifluoromethyl)phenyl)piperazine increases expression EXP 6480464 1-(3-trifluoromethylphenyl)piperazine results in increased expression of RRAGD mRNA CTD PMID:26821219 Rragd Rat 1-benzylpiperazine increases expression EXP 6480464 N-benzylpiperazine results in increased expression of RRAGD mRNA CTD PMID:26821219 Rragd Rat 17alpha-ethynylestradiol affects expression ISO Rragd (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of RRAGD mRNA CTD PMID:17555576 Rragd Rat 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of RRAGD mRNA CTD PMID:26496021 Rragd Rat 2,3',4,4',5-Pentachlorobiphenyl decreases expression ISO Rragd (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Rragd Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Rragd (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of RRAGD mRNA CTD PMID:26377647 Rragd Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of RRAGD mRNA CTD PMID:33387578 Rragd Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression ISO RRAGD (Homo sapiens) 6480464 2 more ... CTD PMID:26705709 Rragd Rat 2-butoxyethanol increases expression ISO Rragd (Mus musculus) 6480464 n-butoxyethanol results in increased expression of RRAGD mRNA CTD PMID:19812364 Rragd Rat 2-hydroxypropanoic acid affects expression ISO RRAGD (Homo sapiens) 6480464 Lactic Acid affects the expression of RRAGD mRNA CTD PMID:30851411 Rragd Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO Rragd (Mus musculus) 6480464 tetrabromobisphenol A results in increased expression of RRAGD mRNA CTD PMID:25172293 Rragd Rat 4-hydroxyphenyl retinamide increases expression ISO Rragd (Mus musculus) 6480464 Fenretinide results in increased expression of RRAGD mRNA CTD PMID:28973697 Rragd Rat 5-aza-2'-deoxycytidine affects expression ISO RRAGD (Homo sapiens) 6480464 Decitabine affects the expression of RRAGD mRNA CTD PMID:23300844 Rragd Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of RRAGD mRNA CTD PMID:24780913 and PMID:25825206 Rragd Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of RRAGD mRNA CTD PMID:31881176 Rragd Rat acrolein multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of RRAGD mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of RRAGD mRNA CTD PMID:32699268 Rragd Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of RRAGD mRNA CTD PMID:28959563 Rragd Rat alpha-pinene multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of RRAGD mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of RRAGD mRNA CTD PMID:32699268 Rragd Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of RRAGD mRNA CTD PMID:35163327 Rragd Rat arsane multiple interactions ISO RRAGD (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of RRAGD mRNA CTD PMID:39836092 Rragd Rat arsenic atom multiple interactions ISO RRAGD (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of RRAGD mRNA CTD PMID:39836092 Rragd Rat arsenite(3-) increases expression ISO Rragd (Mus musculus) 6480464 arsenite results in increased expression of RRAGD mRNA CTD PMID:18929588 Rragd Rat arsenite(3-) multiple interactions ISO Rragd (Mus musculus) 6480464 TRP53 protein affects the reaction [arsenite results in increased expression of RRAGD mRNA] CTD PMID:18929588 Rragd Rat arsenous acid increases expression ISO RRAGD (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of RRAGD mRNA CTD PMID:20458559 Rragd Rat atrazine increases expression ISO RRAGD (Homo sapiens) 6480464 Atrazine results in increased expression of RRAGD mRNA CTD PMID:22378314 Rragd Rat avobenzone increases expression ISO RRAGD (Homo sapiens) 6480464 avobenzone results in increased expression of RRAGD mRNA CTD PMID:31016361 Rragd Rat benzo[a]pyrene increases methylation ISO RRAGD (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of RRAGD promoter CTD PMID:27901495 Rragd Rat benzoates increases expression ISO RRAGD (Homo sapiens) 6480464 Benzoates analog results in increased expression of RRAGD mRNA CTD PMID:29472718 Rragd Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of RRAGD mRNA CTD PMID:26496021 Rragd Rat bisphenol A increases expression ISO Rragd (Mus musculus) 6480464 bisphenol A results in increased expression of RRAGD mRNA CTD PMID:32156529 Rragd Rat bisphenol A increases expression ISO RRAGD (Homo sapiens) 6480464 bisphenol A results in increased expression of RRAGD mRNA CTD PMID:27685785 Rragd Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RRAGD mRNA CTD PMID:25181051 and PMID:34947998 Rragd Rat butan-1-ol multiple interactions ISO RRAGD (Homo sapiens) 6480464 [[Gasoline co-treated with 1-Butanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in decreased expression of RRAGD mRNA CTD PMID:29432896 Rragd Rat butanal increases expression ISO RRAGD (Homo sapiens) 6480464 butyraldehyde results in increased expression of RRAGD mRNA CTD PMID:26079696 Rragd Rat cadmium dichloride increases methylation EXP 6480464 Cadmium Chloride results in increased methylation of RRAGD promoter CTD PMID:22457795 Rragd Rat cannabidiol affects expression EXP 6480464 Cannabidiol affects the expression of RRAGD mRNA CTD PMID:38182033 Rragd Rat capsaicin increases expression ISO RRAGD (Homo sapiens) 6480464 Capsaicin results in increased expression of RRAGD mRNA CTD PMID:36044967 Rragd Rat CGP 52608 multiple interactions ISO RRAGD (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to RRAGD gene] CTD PMID:28238834 Rragd Rat chlordecone multiple interactions ISO Rragd (Mus musculus) 6480464 Chlordecone promotes the reaction [Biomarkers metabolite binds to RRAGD gene] CTD PMID:31084621 Rragd Rat chlorpyrifos increases expression ISO Rragd (Mus musculus) 6480464 Chlorpyrifos results in increased expression of RRAGD mRNA CTD PMID:37019170 Rragd Rat choline multiple interactions ISO Rragd (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of RRAGD mRNA CTD PMID:20938992 Rragd Rat cisplatin increases response to substance ISO RRAGD (Homo sapiens) 6480464 RRAGD protein results in increased susceptibility to Cisplatin CTD PMID:16734730 Rragd Rat cisplatin affects expression ISO RRAGD (Homo sapiens) 6480464 Cisplatin affects the expression of RRAGD mRNA CTD PMID:23300844 Rragd Rat cobalt dichloride increases expression EXP 6480464 cobaltous chloride results in increased expression of RRAGD mRNA CTD PMID:24386269 Rragd Rat copper atom multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Disulfiram binds to Copper] which results in decreased expression of RRAGD mRNA and [NSC 689534 binds to Copper] which results in increased expression of RRAGD mRNA CTD PMID:20971185 and PMID:24690739 Rragd Rat copper atom increases expression EXP 6480464 Copper results in increased expression of RRAGD mRNA CTD PMID:30556269 Rragd Rat copper(0) multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Disulfiram binds to Copper] which results in decreased expression of RRAGD mRNA and [NSC 689534 binds to Copper] which results in increased expression of RRAGD mRNA CTD PMID:20971185 and PMID:24690739 Rragd Rat copper(0) increases expression EXP 6480464 Copper results in increased expression of RRAGD mRNA CTD PMID:30556269 Rragd Rat copper(II) sulfate increases expression ISO RRAGD (Homo sapiens) 6480464 Copper Sulfate results in increased expression of RRAGD mRNA CTD PMID:19549813 Rragd Rat crocidolite asbestos increases expression ISO RRAGD (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of RRAGD mRNA CTD PMID:18687144 Rragd Rat cyclosporin A increases expression ISO RRAGD (Homo sapiens) 6480464 Cyclosporine results in increased expression of RRAGD mRNA CTD PMID:20106945 and PMID:25562108 Rragd Rat diarsenic trioxide increases expression ISO RRAGD (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of RRAGD mRNA CTD PMID:20458559 Rragd Rat Dibutyl phosphate affects expression ISO RRAGD (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RRAGD mRNA CTD PMID:37042841 Rragd Rat dioxygen multiple interactions ISO RRAGD (Homo sapiens) 6480464 1-cyclopropyl-4-(4-((5-methyl-3-(3-(4-(trifluoromethoxy)phenyl)-1 more ... CTD PMID:24403227 Rragd Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in decreased expression of RRAGD mRNA CTD PMID:33729688 Rragd Rat dioxygen increases expression ISO RRAGD (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of RRAGD mRNA CTD PMID:24403227 Rragd Rat disulfiram multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Disulfiram binds to Copper] which results in decreased expression of RRAGD mRNA CTD PMID:24690739 Rragd Rat Doramectin increases expression EXP 6480464 doramectin results in increased expression of RRAGD mRNA CTD PMID:35137919 Rragd Rat dorsomorphin multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Rragd Rat doxorubicin decreases expression ISO RRAGD (Homo sapiens) 6480464 Doxorubicin results in decreased expression of RRAGD mRNA CTD PMID:29803840 Rragd Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of RRAGD mRNA CTD PMID:29391264 Rragd Rat entinostat increases expression ISO RRAGD (Homo sapiens) 6480464 entinostat results in increased expression of RRAGD mRNA CTD PMID:27188386 Rragd Rat ethanol multiple interactions ISO RRAGD (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in decreased expression of RRAGD mRNA CTD PMID:29432896 Rragd Rat ethanol affects splicing ISO Rragd (Mus musculus) 6480464 Ethanol affects the splicing of RRAGD mRNA CTD PMID:30319688 Rragd Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of RRAGD mRNA CTD PMID:30307764 Rragd Rat folic acid multiple interactions ISO Rragd (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of RRAGD mRNA CTD PMID:20938992 Rragd Rat FR900359 affects phosphorylation ISO RRAGD (Homo sapiens) 6480464 FR900359 affects the phosphorylation of RRAGD protein CTD PMID:37730182 Rragd Rat gemcitabine increases expression ISO RRAGD (Homo sapiens) 6480464 Gemcitabine results in increased expression of RRAGD mRNA CTD PMID:17039268 Rragd Rat genistein increases expression ISO Rragd (Mus musculus) 6480464 Genistein results in increased expression of RRAGD mRNA CTD PMID:32186404 Rragd Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of RRAGD mRNA CTD PMID:33387578 Rragd Rat inulin multiple interactions ISO Rragd (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of RRAGD mRNA CTD PMID:36331819 Rragd Rat isobutanol multiple interactions ISO RRAGD (Homo sapiens) 6480464 [[Gasoline co-treated with isobutyl alcohol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in decreased expression of RRAGD mRNA CTD PMID:29432896 Rragd Rat L-methionine multiple interactions ISO Rragd (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of RRAGD mRNA CTD PMID:20938992 Rragd Rat mitoxantrone affects response to substance ISO RRAGD (Homo sapiens) 6480464 RRAGD mRNA affects the susceptibility to Mitoxantrone CTD PMID:16044152 Rragd Rat mono(2-ethylhexyl) phthalate decreases expression ISO Rragd (Mus musculus) 6480464 mono-(2-ethylhexyl)phthalate results in decreased expression of RRAGD mRNA CTD PMID:22401849 Rragd Rat N-methyl-4-phenylpyridinium increases expression EXP 6480464 1-Methyl-4-phenylpyridinium results in increased expression of RRAGD mRNA CTD PMID:28801915 Rragd Rat nickel atom decreases expression ISO RRAGD (Homo sapiens) 6480464 Nickel results in decreased expression of RRAGD mRNA CTD PMID:25583101 Rragd Rat ozone multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of RRAGD mRNA more ... CTD PMID:32699268 Rragd Rat panobinostat multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAGD mRNA CTD PMID:27188386 Rragd Rat panobinostat decreases expression ISO RRAGD (Homo sapiens) 6480464 panobinostat results in decreased expression of RRAGD mRNA CTD PMID:26272509 Rragd Rat paracetamol affects expression ISO Rragd (Mus musculus) 6480464 Acetaminophen affects the expression of RRAGD mRNA CTD PMID:17562736 Rragd Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of RRAGD mRNA CTD PMID:33387578 Rragd Rat pentanal increases expression ISO RRAGD (Homo sapiens) 6480464 pentanal results in increased expression of RRAGD mRNA CTD PMID:26079696 Rragd Rat perfluorohexanesulfonic acid decreases expression ISO Rragd (Mus musculus) 6480464 perfluorohexanesulfonic acid results in decreased expression of RRAGD mRNA CTD PMID:37995155 Rragd Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Rragd (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of RRAGD mRNA CTD PMID:36331819 Rragd Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of RRAGD mRNA CTD PMID:35163327 Rragd Rat phenobarbital affects expression ISO RRAGD (Homo sapiens) 6480464 Phenobarbital affects the expression of RRAGD mRNA CTD PMID:19159669 Rragd Rat phenylmercury acetate decreases expression ISO RRAGD (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of RRAGD mRNA CTD PMID:26272509 Rragd Rat phenylmercury acetate multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAGD mRNA CTD PMID:27188386 Rragd Rat pirinixic acid multiple interactions ISO Rragd (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of RRAGD mRNA CTD PMID:19710929 Rragd Rat potassium dichromate increases expression ISO RRAGD (Homo sapiens) 6480464 Potassium Dichromate results in increased expression of RRAGD protein CTD PMID:23718831 Rragd Rat pravastatin decreases expression ISO Rragd (Mus musculus) 6480464 Pravastatin results in decreased expression of RRAGD mRNA CTD PMID:27225895 Rragd Rat propanal increases expression ISO RRAGD (Homo sapiens) 6480464 propionaldehyde results in increased expression of RRAGD mRNA CTD PMID:26079696 Rragd Rat rac-lactic acid affects expression ISO RRAGD (Homo sapiens) 6480464 Lactic Acid affects the expression of RRAGD mRNA CTD PMID:30851411 Rragd Rat resveratrol multiple interactions ISO RRAGD (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of RRAGD mRNA CTD PMID:23557933 Rragd Rat SB 431542 multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Rragd Rat silicon dioxide increases expression ISO RRAGD (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of RRAGD mRNA CTD PMID:25895662 Rragd Rat silicon dioxide increases expression ISO Rragd (Mus musculus) 6480464 Silicon Dioxide results in increased expression of RRAGD mRNA CTD PMID:29203145 Rragd Rat silver atom decreases expression ISO Rragd (Mus musculus) 6480464 Silver results in decreased expression of RRAGD mRNA CTD PMID:27131904 Rragd Rat silver(0) decreases expression ISO Rragd (Mus musculus) 6480464 Silver results in decreased expression of RRAGD mRNA CTD PMID:27131904 Rragd Rat sodium arsenite multiple interactions ISO RRAGD (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of RRAGD mRNA CTD PMID:39836092 Rragd Rat sodium arsenite decreases expression ISO Rragd (Mus musculus) 6480464 sodium arsenite results in decreased expression of RRAGD mRNA CTD PMID:37682722 Rragd Rat sotorasib multiple interactions ISO RRAGD (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of RRAGD mRNA CTD PMID:36139627 Rragd Rat sunitinib increases expression ISO RRAGD (Homo sapiens) 6480464 Sunitinib results in increased expression of RRAGD mRNA CTD PMID:31533062 Rragd Rat temozolomide decreases expression ISO RRAGD (Homo sapiens) 6480464 Temozolomide results in decreased expression of RRAGD mRNA CTD PMID:31758290 Rragd Rat tert-butyl hydroperoxide increases expression ISO RRAGD (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased expression of RRAGD mRNA CTD PMID:15336504 Rragd Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of RRAGD mRNA CTD PMID:31150632 Rragd Rat titanium dioxide decreases expression ISO Rragd (Mus musculus) 6480464 titanium dioxide results in decreased expression of RRAGD mRNA CTD PMID:23557971 Rragd Rat titanium dioxide decreases methylation ISO Rragd (Mus musculus) 6480464 titanium dioxide results in decreased methylation of RRAGD gene CTD PMID:35295148 Rragd Rat trametinib multiple interactions ISO RRAGD (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of RRAGD mRNA CTD PMID:36139627 Rragd Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of RRAGD mRNA CTD PMID:33387578 Rragd Rat trichostatin A increases expression ISO RRAGD (Homo sapiens) 6480464 trichostatin A results in increased expression of RRAGD mRNA CTD PMID:24935251 Rragd Rat trichostatin A multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of RRAGD mRNA CTD PMID:27188386 Rragd Rat trichostatin A decreases expression ISO RRAGD (Homo sapiens) 6480464 trichostatin A results in decreased expression of RRAGD mRNA CTD PMID:24935251 and PMID:26272509 Rragd Rat triclosan decreases expression ISO RRAGD (Homo sapiens) 6480464 Triclosan results in decreased expression of RRAGD mRNA CTD PMID:30510588 Rragd Rat triphenyl phosphate affects expression ISO RRAGD (Homo sapiens) 6480464 triphenyl phosphate affects the expression of RRAGD mRNA CTD PMID:37042841 Rragd Rat urethane increases expression ISO RRAGD (Homo sapiens) 6480464 Urethane results in increased expression of RRAGD mRNA CTD PMID:28818685 Rragd Rat valproic acid decreases methylation ISO RRAGD (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of RRAGD gene CTD PMID:29154799 Rragd Rat valproic acid increases expression ISO RRAGD (Homo sapiens) 6480464 Valproic Acid results in increased expression of RRAGD mRNA CTD PMID:19101580 more ... Rragd Rat valproic acid multiple interactions ISO RRAGD (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RRAGD mRNA CTD PMID:27188386 Rragd Rat valproic acid affects expression ISO RRAGD (Homo sapiens) 6480464 Valproic Acid affects the expression of RRAGD mRNA CTD PMID:25979313 Rragd Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of RRAGD mRNA CTD PMID:23034163 Rragd Rat zaragozic acid A increases expression ISO Rragd (Mus musculus) 6480464 squalestatin 1 results in increased expression of RRAGD mRNA CTD PMID:27225895 Rragd Rat zaragozic acid A increases expression EXP 6480464 squalestatin 1 results in increased expression of RRAGD mRNA CTD PMID:27225895
Imported Annotations - PID (archival)
1-(3-(trifluoromethyl)phenyl)piperazine (EXP) 1-benzylpiperazine (EXP) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-butoxyethanol (ISO) 2-hydroxypropanoic acid (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) acrolein (ISO) acrylamide (EXP) alpha-pinene (ISO) alpha-Zearalanol (EXP) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) atrazine (ISO) avobenzone (ISO) benzo[a]pyrene (ISO) benzoates (ISO) bisphenol A (EXP,ISO) butan-1-ol (ISO) butanal (ISO) cadmium dichloride (EXP) cannabidiol (EXP) capsaicin (ISO) CGP 52608 (ISO) chlordecone (ISO) chlorpyrifos (ISO) choline (ISO) cisplatin (ISO) cobalt dichloride (EXP) copper atom (EXP,ISO) copper(0) (EXP,ISO) copper(II) sulfate (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dioxygen (EXP,ISO) disulfiram (ISO) Doramectin (EXP) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) entinostat (ISO) ethanol (ISO) fenvalerate (EXP) folic acid (ISO) FR900359 (ISO) gemcitabine (ISO) genistein (ISO) gentamycin (EXP) inulin (ISO) isobutanol (ISO) L-methionine (ISO) mitoxantrone (ISO) mono(2-ethylhexyl) phthalate (ISO) N-methyl-4-phenylpyridinium (EXP) nickel atom (ISO) ozone (ISO) panobinostat (ISO) paracetamol (EXP,ISO) pentanal (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP) phenobarbital (ISO) phenylmercury acetate (ISO) pirinixic acid (ISO) potassium dichromate (ISO) pravastatin (ISO) propanal (ISO) rac-lactic acid (ISO) resveratrol (ISO) SB 431542 (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (ISO) sotorasib (ISO) sunitinib (ISO) temozolomide (ISO) tert-butyl hydroperoxide (ISO) tetrachloromethane (EXP) titanium dioxide (ISO) trametinib (ISO) trichloroethene (EXP) trichostatin A (ISO) triclosan (ISO) triphenyl phosphate (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP) zaragozic acid A (EXP,ISO)
Rragd Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 52,170,234 - 52,205,700 (+) NCBI GRCr8 mRatBN7.2 5 47,373,902 - 47,409,369 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 47,373,463 - 47,409,356 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 49,519,454 - 49,555,330 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 51,118,640 - 51,154,514 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 51,061,448 - 51,097,777 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 48,224,994 - 48,260,691 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 48,224,994 - 48,260,685 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 52,808,853 - 52,844,550 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 49,269,195 - 49,304,824 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 49,269,463 - 49,304,853 (+) NCBI Celera 5 46,131,676 - 46,167,177 (+) NCBI Celera Cytogenetic Map 5 q21 NCBI
RRAGD Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 89,364,616 - 89,412,273 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 89,364,616 - 89,412,273 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 90,074,335 - 90,121,992 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 90,134,313 - 90,178,497 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 90,134,312 - 90,178,484 NCBI Celera 6 90,492,855 - 90,540,521 (-) NCBI Celera Cytogenetic Map 6 q15 NCBI HuRef 6 87,291,456 - 87,339,127 (-) NCBI HuRef CHM1_1 6 90,171,963 - 90,219,638 (-) NCBI CHM1_1 T2T-CHM13v2.0 6 90,573,972 - 90,621,638 (-) NCBI T2T-CHM13v2.0
Rragd Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 32,982,998 - 33,022,180 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 32,983,037 - 33,022,180 (+) Ensembl GRCm39 Ensembl GRCm38 4 32,982,998 - 33,022,180 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 32,983,037 - 33,022,180 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 33,069,973 - 33,109,155 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 4 33,324,445 - 33,347,552 (+) NCBI MGSCv36 mm8 Celera 4 32,723,373 - 32,762,718 (+) NCBI Celera Cytogenetic Map 4 A5 NCBI cM Map 4 14.57 NCBI
Rragd Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955411 16,114,755 - 16,138,433 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955411 16,111,931 - 16,155,662 (-) NCBI ChiLan1.0 ChiLan1.0
RRAGD Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 109,442,312 - 109,490,445 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 107,342,857 - 107,391,191 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 87,237,442 - 87,285,579 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 90,511,250 - 90,558,822 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 90,511,250 - 90,558,822 (-) Ensembl panpan1.1 panPan2
RRAGD Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 48,583,350 - 48,625,032 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 48,585,937 - 48,625,130 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 48,389,944 - 48,431,014 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 49,391,963 - 49,433,035 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 49,391,187 - 49,433,003 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 48,708,215 - 48,749,244 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 48,607,142 - 48,649,369 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 48,799,712 - 48,841,409 (-) NCBI UU_Cfam_GSD_1.0
Rragd Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 83,618,658 - 83,661,798 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936510 2,810,022 - 2,853,306 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936510 2,810,028 - 2,849,792 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
RRAGD Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 57,374,055 - 57,424,061 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 57,374,047 - 57,424,058 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 64,151,948 - 64,213,701 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
RRAGD Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 13 14,129,167 - 14,167,066 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 13 14,132,224 - 14,166,730 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 190,445,641 - 190,484,137 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Rragd
.
Predicted Target Of
Count of predictions: 48 Count of miRNA genes: 42 Interacting mature miRNAs: 47 Transcripts: ENSRNOT00000068028 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2293666 Bmd38 Bone mineral density QTL 38 4.4 femur size trait (VT:1000369) femoral neck cortical cross-sectional area (CMO:0001702) 5 8948228 53948228 Rat 1578776 Stresp18 Stress response QTL 18 2.9 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 5 27955440 72955440 Rat 1298067 Scl15 Serum cholesterol level QTL 15 4.8 0.001 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 33215665 78215665 Rat 1549845 Scl44 Serum cholesterol level QTL 44 6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 40128307 148607290 Rat 70212 Niddm25 Non-insulin dependent diabetes mellitus QTL 25 3.54 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 1 131345958 Rat 1358353 Srcrtb2 Stress Responsive Cort Basal QTL 2 3.48 0.003 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 5 18873947 74251464 Rat 1300117 Hrtrt8 Heart rate QTL 8 3.49 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 5 3844018 47869213 Rat 634305 Mamtr1 Mammary tumor resistance QTL 1 0.0001 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 12789751 113558310 Rat 1331801 Rf33 Renal function QTL 33 4.149 kidney blood vessel physiology trait (VT:0100012) absolute change in renal vascular resistance (CMO:0001900) 5 43726656 129132602 Rat 1598807 Glom12 Glomerulus QTL 12 2.7 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 5 33215665 78215665 Rat 1302786 Kidm8 Kidney mass QTL 8 28.15 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 5 33215665 78215665 Rat 6903292 Stl28 Serum triglyceride level QTL 28 2.6 0.0073 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 5 28515489 73515489 Rat 1578766 Tcas11 Tongue tumor susceptibility QTL 11 4.12 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 5 46711509 161317411 Rat 1578767 Stresp17 Stress response QTL 17 4.3 0.01 blood aldosterone amount (VT:0005346) plasma aldosterone level (CMO:0000551) 5 27955440 72955440 Rat 1641922 Alcrsp8 Alcohol response QTL 8 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 5 35189153 68564008 Rat 1641912 Alcrsp18 Alcohol response QTL 18 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 35189153 141643988 Rat 1576314 Eutr1 Estrogen induced uterine response QTL 1 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 2138965 166875058 Rat 6903306 Scl35 Serum cholesterol QTL 35 2.6 0.0073 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 28515489 73515489 Rat 1576317 Eutr2 Estrogen induced uterine response QTL 2 0.01 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 34730116 104251008 Rat 7394712 Emca13 Estrogen-induced mammary cancer QTL 13 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 9823266 99753708 Rat 1331773 Scl26 Serum cholesterol level QTL 26 3.065 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 43726656 86724018 Rat 1331771 Rf35 Renal function QTL 35 4.36965 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 729470 86724018 Rat 8662454 Vetf3 Vascular elastic tissue fragility QTL 3 27.4 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 5 2282226 69540447 Rat 2290448 Scl54 Serum cholesterol level QTL 54 2.93 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 31663789 131345958 Rat 1641903 Alcrsp3 Alcohol response QTL 3 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 12689285 57689285 Rat 1331756 Rf34 Renal function QTL 34 4.16275 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 1 90450412 Rat 8552954 Pigfal14 Plasma insulin-like growth factor 1 level QTL 14 9 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 21226744 66226744 Rat 2316959 Gluco59 Glucose level QTL 59 4.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 34944474 113558310 Rat 1600358 Mamtr5 Mammary tumor resistance QTL 5 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 18873947 63873947 Rat
BE102187
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 5 47,381,784 - 47,381,943 (+) MAPPER mRatBN7.2 Rnor_6.0 5 48,232,879 - 48,233,037 NCBI Rnor6.0 Rnor_5.0 5 52,816,738 - 52,816,896 UniSTS Rnor5.0 RGSC_v3.4 5 49,277,080 - 49,277,238 UniSTS RGSC3.4 Celera 5 46,139,561 - 46,139,719 UniSTS RH 3.4 Map 5 248.2 UniSTS Cytogenetic Map 5 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000068028 ⟹ ENSRNOP00000061453
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 47,373,463 - 47,409,356 (+) Ensembl Rnor_6.0 Ensembl 5 48,224,994 - 48,260,685 (+) Ensembl
RefSeq Acc Id:
NM_001106641 ⟹ NP_001100111
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 52,170,234 - 52,205,700 (+) NCBI mRatBN7.2 5 47,373,902 - 47,409,369 (+) NCBI Rnor_6.0 5 48,224,994 - 48,260,691 (+) NCBI Rnor_5.0 5 52,808,853 - 52,844,550 (+) NCBI RGSC_v3.4 5 49,269,195 - 49,304,824 (+) RGD Celera 5 46,131,676 - 46,167,177 (+) RGD
Sequence:
GGGCTGGGCTCCGTGCCACCCCCTCGCTCACCAGGAGCGGCCCCGGGGCGCTGCGGGCCACTCGGCCCACGCGGGACCTCGGAGGCAAGCGTGGGCGTGATGAGCCAGGTGCTGGGCAAGCCGCAGCC
hide sequence
RefSeq Acc Id:
NP_001100111 ⟸ NM_001106641
- UniProtKB:
B2RZ38 (UniProtKB/TrEMBL), E9PSZ8 (UniProtKB/TrEMBL), A0A9K3Y831 (UniProtKB/TrEMBL), A6IIK3 (UniProtKB/TrEMBL)
- Sequence:
MSQVLGKPQPQGEDGGDDEEEDELVGLAGYEDGPESSDAELDSGPEEGVLDFSDPFSTEVKPRILLMGLRRSGKSSIQKVVFHKMSPSETLFLESTNRICREDVSNSSFVNFQIWDFPGQIDFFDPTF
hide sequence
Ensembl Acc Id:
ENSRNOP00000061453 ⟸ ENSRNOT00000068028
RGD ID: 13693611 Promoter ID: EPDNEW_R4136 Type: single initiation site Name: Rragd_1 Description: Ras-related GTP binding D SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 5 48,224,926 - 48,224,986 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Rragd
Ras-related GTP binding D
Rragd_predicted
Ras-related GTP binding D (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Rragd_predicted
Ras-related GTP binding D (predicted)
Symbol and Name status set to approved
70820 APPROVED
