Symbol:
Lrpprc
Name:
leucine-rich pentatricopeptide repeat containing
RGD ID:
1306575
Description:
Predicted to enable several functions, including beta-tubulin binding activity; mRNA 3'-UTR binding activity; and ubiquitin protein ligase binding activity. Predicted to be involved in regulation of mitochondrial translation. Predicted to act upstream of or within negative regulation of mitochondrial RNA catabolic process. Predicted to be located in several cellular components, including condensed nuclear chromosome; mitochondrial nucleoid; and perinuclear region of cytoplasm. Predicted to be part of ribonucleoprotein complex. Predicted to be active in mitochondrion and nucleus. Human ortholog(s) of this gene implicated in French Canadian Leigh disease and Leigh disease. Orthologous to human LRPPRC (leucine rich pentatricopeptide repeat containing); PARTICIPATES IN CRM1 export pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; aconitine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
130 kDa leucine-rich protein; leucine rich protein 157; leucine-rich PPR motif-containing protein, mitochondrial; leucine-rich PPR-motif containing; leucine-rich protein 157; LOC313867; LRP 130; Lrp157; rLRP157
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 6 15,612,638 - 15,695,113 (+) NCBI GRCr8 mRatBN7.2 6 9,859,816 - 9,942,294 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 6 9,859,867 - 9,942,293 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 6 10,148,236 - 10,230,722 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 6 10,457,631 - 10,540,115 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 6 9,979,042 - 10,061,742 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 6 7,984,043 - 8,066,874 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 6 7,984,019 - 8,066,868 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 6 7,919,928 - 8,001,949 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 6 8,086,606 - 8,168,261 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 6 8,086,606 - 8,168,261 (-) NCBI Celera 6 9,581,533 - 9,663,935 (+) NCBI Celera Cytogenetic Map 6 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Lrpprc Rat (1->4)-beta-D-glucan multiple interactions ISO Lrpprc (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of LRPPRC mRNA CTD PMID:36331819 Lrpprc Rat 1,2-dimethylhydrazine increases expression ISO Lrpprc (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of LRPPRC mRNA CTD PMID:22206623 Lrpprc Rat 1,2-dimethylhydrazine multiple interactions ISO Lrpprc (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of LRPPRC mRNA CTD PMID:22206623 Lrpprc Rat 17alpha-ethynylestradiol multiple interactions ISO Lrpprc (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of LRPPRC mRNA CTD PMID:17942748 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Lrpprc (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of LRPPRC mRNA CTD PMID:17942748 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of LRPPRC mRNA CTD PMID:32277265 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Lrpprc (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of LRPPRC mRNA CTD PMID:21570461 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO LRPPRC (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of LRPPRC mRNA CTD PMID:21632981 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of LRPPRC mRNA CTD PMID:21215274 and PMID:33387578 Lrpprc Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Lrpprc (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of LRPPRC mRNA CTD PMID:19770486 Lrpprc Rat 2,6-dimethoxyphenol multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Lrpprc Rat 3',5'-cyclic UMP affects binding ISO LRPPRC (Homo sapiens) 6480464 LRPPRC protein binds to cyclic 3' and 5'-uridine monophosphate CTD PMID:30528433 Lrpprc Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of LRPPRC mRNA CTD PMID:28628672 Lrpprc Rat 4,4'-sulfonyldiphenol increases expression ISO LRPPRC (Homo sapiens) 6480464 bisphenol S results in increased expression of LRPPRC protein CTD PMID:34186270 Lrpprc Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of LRPPRC mRNA CTD PMID:30047161 Lrpprc Rat aconitine increases expression EXP 6480464 Aconitine results in increased expression of LRPPRC protein CTD PMID:33236894 Lrpprc Rat acrolein multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of LRPPRC mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased expression of LRPPRC mRNA CTD PMID:32699268 Lrpprc Rat acrylamide increases expression ISO Lrpprc (Mus musculus) 6480464 Acrylamide results in increased expression of LRPPRC mRNA CTD PMID:30807115 Lrpprc Rat actinomycin D multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of LRPPRC protein CTD PMID:38460933 Lrpprc Rat all-trans-retinoic acid decreases expression ISO LRPPRC (Homo sapiens) 6480464 Tretinoin results in decreased expression of LRPPRC mRNA CTD PMID:33167477 Lrpprc Rat alpha-pinene multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of LRPPRC mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased expression of LRPPRC mRNA CTD PMID:32699268 Lrpprc Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of LRPPRC mRNA CTD PMID:30047161 Lrpprc Rat aristolochic acid A decreases expression ISO LRPPRC (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of LRPPRC mRNA CTD PMID:33212167 Lrpprc Rat arsane affects methylation ISO LRPPRC (Homo sapiens) 6480464 Arsenic affects the methylation of LRPPRC gene CTD PMID:25304211 Lrpprc Rat arsenic atom affects methylation ISO LRPPRC (Homo sapiens) 6480464 Arsenic affects the methylation of LRPPRC gene CTD PMID:25304211 Lrpprc Rat arsenite(3-) multiple interactions ISO LRPPRC (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to LRPPRC mRNA] CTD PMID:32406909 Lrpprc Rat atrazine decreases expression ISO LRPPRC (Homo sapiens) 6480464 Atrazine results in decreased expression of LRPPRC mRNA CTD PMID:22378314 Lrpprc Rat benzo[a]pyrene decreases expression ISO Lrpprc (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of LRPPRC mRNA CTD PMID:20504355 Lrpprc Rat benzo[a]pyrene decreases methylation ISO Lrpprc (Mus musculus) 6480464 Benzo(a)pyrene results in decreased methylation of LRPPRC intron CTD PMID:27901495 Lrpprc Rat benzo[a]pyrene increases expression ISO Lrpprc (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of LRPPRC mRNA CTD PMID:22228805 Lrpprc Rat benzo[a]pyrene diol epoxide I decreases expression ISO LRPPRC (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Lrpprc Rat bis(2-ethylhexyl) phthalate decreases expression ISO Lrpprc (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of LRPPRC mRNA CTD PMID:33754040 Lrpprc Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of LRPPRC mRNA CTD PMID:25181051 Lrpprc Rat bisphenol A decreases expression ISO LRPPRC (Homo sapiens) 6480464 bisphenol A results in decreased expression of LRPPRC protein CTD PMID:34186270 Lrpprc Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of LRPPRC protein CTD PMID:32145629 Lrpprc Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of LRPPRC mRNA CTD PMID:30816183 Lrpprc Rat bisphenol AF increases expression ISO LRPPRC (Homo sapiens) 6480464 bisphenol AF results in increased expression of LRPPRC protein CTD PMID:34186270 Lrpprc Rat Bisphenol B increases expression ISO LRPPRC (Homo sapiens) 6480464 bisphenol B results in increased expression of LRPPRC protein CTD PMID:34186270 Lrpprc Rat bisphenol F multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of LRPPRC mRNA CTD PMID:28628672 Lrpprc Rat bisphenol F increases expression ISO LRPPRC (Homo sapiens) 6480464 bisphenol F results in increased expression of LRPPRC protein CTD PMID:34186270 Lrpprc Rat Brodifacoum increases expression EXP 6480464 bromfenacoum results in increased expression of LRPPRC protein CTD PMID:28903499 Lrpprc Rat butanal decreases expression ISO LRPPRC (Homo sapiens) 6480464 butyraldehyde results in decreased expression of LRPPRC mRNA CTD PMID:26079696 Lrpprc Rat C60 fullerene decreases expression EXP 6480464 fullerene C60 results in decreased expression of LRPPRC mRNA CTD PMID:19167457 Lrpprc Rat cadmium dichloride decreases methylation EXP 6480464 Cadmium Chloride results in decreased methylation of LRPPRC promoter CTD PMID:22457795 Lrpprc Rat cadmium dichloride decreases expression ISO LRPPRC (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of LRPPRC mRNA CTD PMID:38568856 Lrpprc Rat CGP 52608 multiple interactions ISO LRPPRC (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to LRPPRC gene] CTD PMID:28238834 Lrpprc Rat chlorpyrifos decreases expression ISO Lrpprc (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of LRPPRC mRNA CTD PMID:37019170 Lrpprc Rat chromium(6+) affects expression ISO Lrpprc (Mus musculus) 6480464 chromium hexavalent ion affects the expression of LRPPRC mRNA CTD PMID:28472532 Lrpprc Rat clofibric acid affects expression EXP 6480464 Clofibric Acid affects the expression of LRPPRC mRNA CTD PMID:17602206 Lrpprc Rat clozapine increases expression ISO LRPPRC (Homo sapiens) 6480464 Clozapine results in increased expression of LRPPRC protein CTD PMID:34122009 Lrpprc Rat corosolic acid decreases expression ISO LRPPRC (Homo sapiens) 6480464 corosolic acid results in decreased expression of LRPPRC mRNA CTD PMID:37939859 Lrpprc Rat cyclosporin A decreases expression ISO Lrpprc (Mus musculus) 6480464 Cyclosporine results in decreased expression of LRPPRC mRNA CTD PMID:19770486 Lrpprc Rat dexamethasone multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of LRPPRC mRNA CTD PMID:28628672 Lrpprc Rat dicrotophos decreases expression ISO LRPPRC (Homo sapiens) 6480464 dicrotophos results in decreased expression of LRPPRC mRNA CTD PMID:28302478 Lrpprc Rat dioxygen increases expression ISO Lrpprc (Mus musculus) 6480464 Oxygen deficiency results in increased expression of LRPPRC mRNA CTD PMID:24205000 Lrpprc Rat dorsomorphin multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of LRPPRC mRNA CTD PMID:27188386 Lrpprc Rat doxorubicin increases expression ISO LRPPRC (Homo sapiens) 6480464 Doxorubicin results in increased expression of LRPPRC mRNA CTD PMID:29803840 Lrpprc Rat enzyme inhibitor multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of LRPPRC protein CTD PMID:23301498 Lrpprc Rat epoxiconazole decreases expression ISO Lrpprc (Mus musculus) 6480464 epoxiconazole results in decreased expression of LRPPRC mRNA CTD PMID:35436446 Lrpprc Rat ethyl methanesulfonate decreases expression ISO LRPPRC (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of LRPPRC mRNA CTD PMID:23649840 Lrpprc Rat finasteride increases expression EXP 6480464 Finasteride results in increased expression of LRPPRC mRNA CTD PMID:24136188 Lrpprc Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of LRPPRC mRNA CTD PMID:24136188 Lrpprc Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of LRPPRC mRNA CTD PMID:24793618 Lrpprc Rat folic acid multiple interactions ISO Lrpprc (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of LRPPRC mRNA CTD PMID:22206623 Lrpprc Rat formaldehyde decreases expression ISO LRPPRC (Homo sapiens) 6480464 Formaldehyde results in decreased expression of LRPPRC mRNA CTD PMID:20655997 and PMID:23649840 Lrpprc Rat furfural multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Lrpprc Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of LRPPRC mRNA and Gentamicins results in increased expression of LRPPRC protein CTD PMID:22061828 Lrpprc Rat ginsenoside Re increases expression ISO Lrpprc (Mus musculus) 6480464 ginsenoside Re results in increased expression of LRPPRC protein CTD PMID:23144451 Lrpprc Rat indometacin multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of LRPPRC mRNA CTD PMID:28628672 Lrpprc Rat isoprenaline multiple interactions EXP 6480464 [Isoproterenol co-treated with POSTN protein] results in decreased expression of LRPPRC mRNA CTD PMID:30303030 Lrpprc Rat ivermectin decreases expression ISO LRPPRC (Homo sapiens) 6480464 Ivermectin results in decreased expression of LRPPRC protein CTD PMID:32959892 Lrpprc Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of LRPPRC mRNA CTD PMID:30467583 Lrpprc Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of LRPPRC mRNA CTD PMID:30047161 Lrpprc Rat methyl methanesulfonate decreases expression ISO LRPPRC (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of LRPPRC mRNA CTD PMID:23649840 Lrpprc Rat methylmercury chloride increases expression ISO LRPPRC (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of LRPPRC mRNA CTD PMID:28001369 Lrpprc Rat morphine increases expression ISO Lrpprc (Mus musculus) 6480464 Morphine results in increased expression of LRPPRC mRNA CTD PMID:20144693 Lrpprc Rat N-methyl-4-phenylpyridinium increases expression ISO LRPPRC (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of LRPPRC protein CTD PMID:24675778 Lrpprc Rat Nutlin-3 multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of LRPPRC protein CTD PMID:38460933 Lrpprc Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of LRPPRC mRNA CTD PMID:25729387 Lrpprc Rat ozone multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of LRPPRC mRNA more ... CTD PMID:32699268 Lrpprc Rat paracetamol affects expression ISO Lrpprc (Mus musculus) 6480464 Acetaminophen affects the expression of LRPPRC mRNA CTD PMID:17562736 Lrpprc Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Lrpprc (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of LRPPRC mRNA CTD PMID:36331819 Lrpprc Rat pirinixic acid increases expression ISO Lrpprc (Mus musculus) 6480464 pirinixic acid results in increased expression of LRPPRC mRNA CTD PMID:17426115 Lrpprc Rat pirinixic acid increases expression EXP 6480464 pirinixic acid results in increased expression of LRPPRC mRNA CTD PMID:22484513 Lrpprc Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of LRPPRC protein CTD PMID:35544339 Lrpprc Rat S-butyl-DL-homocysteine (S,R)-sulfoximine increases expression EXP 6480464 Buthionine Sulfoximine results in increased expression of LRPPRC protein CTD PMID:23736079 Lrpprc Rat SB 431542 multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 and PMID:37664457 Lrpprc Rat sodium arsenite decreases expression ISO LRPPRC (Homo sapiens) 6480464 sodium arsenite results in decreased expression of LRPPRC mRNA and sodium arsenite results in decreased expression of LRPPRC protein CTD PMID:20050688 more ... Lrpprc Rat sodium chloride multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of LRPPRC protein more ... CTD PMID:38598786 Lrpprc Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of LRPPRC mRNA CTD PMID:30047161 Lrpprc Rat sulindac decreases expression EXP 6480464 Sulindac results in decreased expression of LRPPRC mRNA CTD PMID:24136188 Lrpprc Rat sunitinib increases expression ISO LRPPRC (Homo sapiens) 6480464 Sunitinib results in increased expression of LRPPRC mRNA CTD PMID:31533062 Lrpprc Rat tanespimycin multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [tanespimycin co-treated with VER 155008] results in increased expression of LRPPRC protein CTD PMID:31370342 Lrpprc Rat thapsigargin increases expression ISO Lrpprc (Mus musculus) 6480464 Thapsigargin results in increased expression of LRPPRC protein CTD PMID:24648495 Lrpprc Rat thimerosal increases expression ISO LRPPRC (Homo sapiens) 6480464 Thimerosal results in increased expression of LRPPRC mRNA CTD PMID:27188386 Lrpprc Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of LRPPRC mRNA CTD PMID:34492290 Lrpprc Rat thiram decreases expression ISO LRPPRC (Homo sapiens) 6480464 Thiram results in decreased expression of LRPPRC mRNA CTD PMID:38568856 Lrpprc Rat titanium dioxide decreases methylation ISO Lrpprc (Mus musculus) 6480464 titanium dioxide results in decreased methylation of LRPPRC gene CTD PMID:35295148 Lrpprc Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of LRPPRC mRNA CTD PMID:25729387 Lrpprc Rat trichostatin A increases expression ISO LRPPRC (Homo sapiens) 6480464 trichostatin A results in increased expression of LRPPRC mRNA CTD PMID:24935251 Lrpprc Rat trimellitic anhydride increases expression ISO Lrpprc (Mus musculus) 6480464 trimellitic anhydride results in increased expression of LRPPRC mRNA CTD PMID:19042947 Lrpprc Rat triphenyl phosphate affects expression ISO LRPPRC (Homo sapiens) 6480464 triphenyl phosphate affects the expression of LRPPRC mRNA CTD PMID:37042841 Lrpprc Rat triptonide increases expression ISO Lrpprc (Mus musculus) 6480464 triptonide results in increased expression of LRPPRC mRNA CTD PMID:33045310 Lrpprc Rat valproic acid affects expression ISO Lrpprc (Mus musculus) 6480464 Valproic Acid affects the expression of LRPPRC mRNA CTD PMID:17963808 Lrpprc Rat valproic acid multiple interactions ISO LRPPRC (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of LRPPRC mRNA CTD PMID:27188386 Lrpprc Rat valproic acid increases expression ISO LRPPRC (Homo sapiens) 6480464 Valproic Acid results in increased expression of LRPPRC mRNA CTD PMID:23179753 more ... Lrpprc Rat valproic acid affects expression ISO LRPPRC (Homo sapiens) 6480464 Valproic Acid affects the expression of LRPPRC mRNA CTD PMID:25979313 Lrpprc Rat valproic acid decreases methylation ISO LRPPRC (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of LRPPRC gene CTD PMID:29154799 Lrpprc Rat vinclozolin increases expression EXP 6480464 vinclozolin results in increased expression of LRPPRC mRNA CTD PMID:23034163
(1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 3',5'-cyclic UMP (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) aconitine (EXP) acrolein (ISO) acrylamide (ISO) actinomycin D (ISO) all-trans-retinoic acid (ISO) alpha-pinene (ISO) amitrole (EXP) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) atrazine (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) Brodifacoum (EXP) butanal (ISO) C60 fullerene (EXP) cadmium dichloride (EXP,ISO) CGP 52608 (ISO) chlorpyrifos (ISO) chromium(6+) (ISO) clofibric acid (EXP) clozapine (ISO) corosolic acid (ISO) cyclosporin A (ISO) dexamethasone (ISO) dicrotophos (ISO) dioxygen (ISO) dorsomorphin (ISO) doxorubicin (ISO) enzyme inhibitor (ISO) epoxiconazole (ISO) ethyl methanesulfonate (ISO) finasteride (EXP) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) furfural (ISO) gentamycin (EXP) ginsenoside Re (ISO) indometacin (ISO) isoprenaline (EXP) ivermectin (ISO) methapyrilene (EXP) methimazole (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) morphine (ISO) N-methyl-4-phenylpyridinium (ISO) Nutlin-3 (ISO) oxaliplatin (EXP) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) pirinixic acid (EXP,ISO) rotenone (EXP) S-butyl-DL-homocysteine (S,R)-sulfoximine (EXP) SB 431542 (ISO) sodium arsenite (ISO) sodium chloride (ISO) sulfadimethoxine (EXP) sulindac (EXP) sunitinib (ISO) tanespimycin (ISO) thapsigargin (ISO) thimerosal (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) topotecan (EXP) trichostatin A (ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) triptonide (ISO) valproic acid (ISO) vinclozolin (EXP)
Cellular Component
condensed nuclear chromosome (IEA,ISO,ISS) cytoplasm (IEA,ISO) cytoskeleton (IEA,ISO,ISS) membrane (IEA) microtubule (IEA,ISO) mitochondrial matrix (IEA,ISO) mitochondrial nucleoid (IEA,ISO) mitochondrion (IBA,IEA,ISO,ISS) nuclear inner membrane (IEA) nuclear outer membrane (IEA) nucleoplasm (IEA) nucleus (IBA,IEA,ISO,ISS) perinuclear region of cytoplasm (IEA,ISO,ISS) ribonucleoprotein complex (IEA,ISO)
Lrpprc Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 6 15,612,638 - 15,695,113 (+) NCBI GRCr8 mRatBN7.2 6 9,859,816 - 9,942,294 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 6 9,859,867 - 9,942,293 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 6 10,148,236 - 10,230,722 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 6 10,457,631 - 10,540,115 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 6 9,979,042 - 10,061,742 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 6 7,984,043 - 8,066,874 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 6 7,984,019 - 8,066,868 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 6 7,919,928 - 8,001,949 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 6 8,086,606 - 8,168,261 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 6 8,086,606 - 8,168,261 (-) NCBI Celera 6 9,581,533 - 9,663,935 (+) NCBI Celera Cytogenetic Map 6 q12 NCBI
LRPPRC Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 43,886,224 - 43,996,265 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 43,886,224 - 43,996,226 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 44,113,363 - 44,223,128 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 43,968,391 - 44,076,648 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 44,026,537 - 44,134,795 NCBI Celera 2 43,952,087 - 44,062,100 (-) NCBI Celera Cytogenetic Map 2 p21 NCBI HuRef 2 43,849,689 - 43,959,564 (-) NCBI HuRef CHM1_1 2 44,042,771 - 44,152,581 (-) NCBI CHM1_1 T2T-CHM13v2.0 2 43,891,557 - 44,001,630 (-) NCBI T2T-CHM13v2.0
Lrpprc Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 85,012,675 - 85,098,214 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 85,012,675 - 85,098,217 (-) Ensembl GRCm39 Ensembl GRCm38 17 84,705,247 - 84,790,786 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 84,705,247 - 84,790,789 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 85,104,587 - 85,190,126 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 84,613,573 - 84,698,841 (-) NCBI MGSCv36 mm8 Celera 17 89,073,226 - 89,158,633 (-) NCBI Celera Cytogenetic Map 17 E4 NCBI cM Map 17 55.02 NCBI
Lrpprc Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955441 11,012,910 - 11,116,965 (-) NCBI ChiLan1.0 ChiLan1.0
LRPPRC Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 82,421,380 - 82,530,685 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 82,425,351 - 82,535,405 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 43,975,949 - 44,083,846 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 44,914,578 - 45,021,434 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 44,914,578 - 45,021,434 (-) Ensembl panpan1.1 panPan2
LRPPRC Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 46,325,312 - 46,438,376 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 46,327,223 - 46,438,342 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 46,188,975 - 46,300,206 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 47,205,831 - 47,317,113 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 47,203,961 - 47,317,132 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 46,914,258 - 47,025,488 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 47,203,848 - 47,313,376 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 47,387,584 - 47,498,808 (-) NCBI UU_Cfam_GSD_1.0
Lrpprc
LRPPRC Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 96,474,549 - 96,595,143 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 96,474,510 - 96,590,706 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 102,630,054 - 102,744,878 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
LRPPRC
Lrpprc
.
Predicted Target Of
Count of predictions: 20 Count of miRNA genes: 18 Interacting mature miRNAs: 19 Transcripts: ENSRNOT00000008200 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
8552962 Pigfal16 Plasma insulin-like growth factor 1 level QTL 16 9.4 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 6 1 41223769 Rat 1549905 Stresp10 Stress response QTL 10 6.83 0.0066 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 6 1 27574569 Rat 8693699 Alc37 Alcohol consumption QTL 37 2.6 0.224 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 6 7964167 21301982 Rat 1331743 Uae28 Urinary albumin excretion QTL 28 4.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 6 1 34235784 Rat 1300164 Rf15 Renal function QTL 15 3.12 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 6 5074497 54641141 Rat 9589129 Insul24 Insulin level QTL 24 19.06 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 6 1 41223769 Rat 1578758 Tcas9 Tongue tumor susceptibility QTL 9 3.29 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 6 1 37618905 Rat 7411603 Foco13 Food consumption QTL 13 5.5 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 6 1 41223769 Rat 1598843 Cm63 Cardiac mass QTL 63 2.6 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 6 1 39036266 Rat 738024 Sach5 Saccharine consumption QTL 5 3.9 0.00039 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 6 1 43394190 Rat 7411542 Bw127 Body weight QTL 127 5.5 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 6 1 41223769 Rat 2293706 Bmd20 Bone mineral density QTL 20 4.3 0.0002 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 6 5074497 19988050 Rat 9589048 Scfw3 Subcutaneous fat weight QTL 3 4.57 0.001 subcutaneous adipose mass (VT:1000472) abdominal subcutaneous fat pad weight (CMO:0002069) 6 1 41223769 Rat 2292616 Ept15 Estrogen-induced pituitary tumorigenesis QTL 15 4.4 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 6 9843312 20338915 Rat 738023 Alc17 Alcohol consumption QTL 17 3.1 0.003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 6 1 27574569 Rat 1354616 Despr12 Despair related QTL 12 0.0012 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 6 1 27574569 Rat 2293709 Bss23 Bone structure and strength QTL 23 5.18 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 6 1 42487980 Rat 2293650 Bss31 Bone structure and strength QTL 31 5.05 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 6 1 42487980 Rat 7411584 Foco4 Food consumption QTL 4 4.3 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 6 1 42838846 Rat 2300176 Bmd51 Bone mineral density QTL 51 11.7 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 6 1 27574569 Rat 1300128 Rf16 Renal function QTL 16 3.89 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 6 5074497 34434305 Rat 2301972 Bp325 Blood pressure QTL 325 4.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 6 1 72227641 Rat 2293656 Bss28 Bone structure and strength QTL 28 6.79 0.0001 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 6 1 42487980 Rat 1358190 Ept1 Estrogen-induced pituitary tumorigenesis QTL 1 4.4 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 6 9843312 20338915 Rat 2300190 Bmd52 Bone mineral density QTL 52 11.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 6 1 27574569 Rat 8693690 Alc35 Alcohol consumption QTL 35 2.2 0.606 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 6 7964167 21301982 Rat
D6Got4
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 6 9,892,700 - 9,892,994 (-) MAPPER mRatBN7.2 Rnor_6.0 6 8,033,341 - 8,033,634 NCBI Rnor6.0 Rnor_5.0 6 7,969,226 - 7,969,519 UniSTS Rnor5.0 RGSC_v3.4 6 8,135,903 - 8,136,197 RGD RGSC3.4 RGSC_v3.4 6 8,135,904 - 8,136,197 UniSTS RGSC3.4 RGSC_v3.1 6 8,135,903 - 8,136,197 RGD Celera 6 9,614,357 - 9,614,650 UniSTS Cytogenetic Map 6 q12 UniSTS
RH132068
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 6 9,890,527 - 9,890,736 (-) MAPPER mRatBN7.2 Rnor_6.0 6 8,035,599 - 8,035,807 NCBI Rnor6.0 Rnor_5.0 6 7,971,484 - 7,971,692 UniSTS Rnor5.0 RGSC_v3.4 6 8,138,162 - 8,138,370 UniSTS RGSC3.4 Celera 6 9,612,184 - 9,612,392 UniSTS Cytogenetic Map 6 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000008200 ⟹ ENSRNOP00000008200
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 6 9,859,867 - 9,942,293 (+) Ensembl Rnor_6.0 Ensembl 6 7,984,019 - 8,066,868 (-) Ensembl
RefSeq Acc Id:
NM_001008519 ⟹ NP_001008519
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 6 15,612,638 - 15,695,113 (+) NCBI mRatBN7.2 6 9,859,816 - 9,942,294 (+) NCBI Rnor_6.0 6 7,984,043 - 8,066,874 (-) NCBI Rnor_5.0 6 7,919,928 - 8,001,949 (-) NCBI RGSC_v3.4 6 8,086,606 - 8,168,261 (-) RGD Celera 6 9,581,533 - 9,663,935 (+) RGD
Sequence:
CGGTGAACCATGTCAGCCCTGCTGAGACCCGCGCGTTGGCTGCTAGGGGCAGCGGCGGTCCCGCGCCTCCCGCTGTCCCTGCGCCTCCCTGCGGGCGGCCCCGGCAGGCTGCCCTCTGTCGTCCGGGT
hide sequence
RefSeq Acc Id:
NP_001008519 ⟸ NM_001008519
- Peptide Label:
precursor
- UniProtKB:
Q5SGE0 (UniProtKB/Swiss-Prot), A6H9I4 (UniProtKB/TrEMBL)
- Sequence:
MSALLRPARWLLGAAAVPRLPLSLRLPAGGPGRLPSVVRVAAAGGRPAAGELLSQARLYAIVAEKKDLPEEPAPVRRSGSQFDWALMRLDNSVRRTGRITKGLLQKVFESTCRSGSPGSNQALLLLRS
hide sequence
Ensembl Acc Id:
ENSRNOP00000008200 ⟸ ENSRNOT00000008200
RGD ID: 13694377 Promoter ID: EPDNEW_R4902 Type: initiation region Name: Lrpprc_1 Description: leucine-rich pentatricopeptide repeat containing SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 6 8,066,908 - 8,066,968 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2012-10-02
Lrpprc
leucine-rich pentatricopeptide repeat containing
Lrpprc
leucine-rich PPR-motif containing
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Lrpprc
leucine-rich PPR-motif containing
Lrpprc_predicted
leucine-rich PPR-motif containing (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Lrpprc_predicted
leucine-rich PPR-motif containing (predicted)
Symbol and Name status set to approved
70820 APPROVED
