Symbol:
Wdfy1
Name:
WD repeat and FYVE domain containing 1
RGD ID:
1305996
Description:
Predicted to enable 1-phosphatidylinositol binding activity. Predicted to be involved in positive regulation of toll-like receptor 3 signaling pathway and positive regulation of toll-like receptor 4 signaling pathway. Predicted to be located in several cellular components, including Golgi apparatus; cytosol; and nucleolus. Predicted to be active in early endosome. Orthologous to human WDFY1 (WD repeat and FYVE domain containing 1); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3,4-methylenedioxymethamphetamine; bisphenol A.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC108351959; LOC301549; MGC93914; uncharacterized LOC108351959; WD repeat and FYVE domain-containing protein 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 88,459,613 - 88,541,215 (-) NCBI GRCr8 mRatBN7.2 9 81,034,852 - 81,092,823 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 81,034,849 - 81,092,775 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 89,464,594 - 89,522,539 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 94,593,490 - 94,651,433 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 92,976,004 - 93,033,955 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 85,477,070 - 85,528,885 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 85,475,841 - 85,528,869 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 85,228,597 - 85,280,673 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 79,010,150 - 79,059,470 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 79,193,571 - 79,242,889 (-) NCBI Celera 9 78,532,988 - 78,582,544 (-) NCBI Celera Cytogenetic Map 9 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Wdfy1 Rat 1,2-dichloroethane decreases expression ISO Wdfy1 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of WDFY1 mRNA CTD PMID:28189721 and PMID:28960355 Wdfy1 Rat 1,2-dimethylhydrazine multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of WDFY1 mRNA CTD PMID:22206623 Wdfy1 Rat 1,2-dimethylhydrazine decreases expression ISO Wdfy1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of WDFY1 mRNA CTD PMID:22206623 Wdfy1 Rat 17beta-estradiol multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [Polyphenols co-treated with Estradiol] results in increased expression of WDFY1 mRNA CTD PMID:30077407 Wdfy1 Rat 17beta-estradiol decreases expression ISO Wdfy1 (Mus musculus) 6480464 Estradiol results in decreased expression of WDFY1 mRNA CTD PMID:39298647 Wdfy1 Rat 17beta-estradiol increases expression ISO Wdfy1 (Mus musculus) 6480464 Estradiol results in increased expression of WDFY1 mRNA CTD PMID:30077407 Wdfy1 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO WDFY1 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Wdfy1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Wdfy1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of WDFY1 mRNA CTD PMID:21570461 Wdfy1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of WDFY1 mRNA CTD PMID:34747641 Wdfy1 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO WDFY1 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of WDFY1 protein CTD PMID:31675489 Wdfy1 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Wdfy1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of WDFY1 mRNA CTD PMID:20188158 Wdfy1 Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of WDFY1 mRNA CTD PMID:30071829 Wdfy1 Rat 4,4'-diaminodiphenylmethane affects expression ISO Wdfy1 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane affects the expression of WDFY1 mRNA CTD PMID:18648102 Wdfy1 Rat 4,4'-sulfonyldiphenol decreases expression ISO Wdfy1 (Mus musculus) 6480464 bisphenol S results in decreased expression of WDFY1 mRNA CTD PMID:39298647 Wdfy1 Rat acrolein multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased oxidation of WDFY1 mRNA CTD PMID:32845096 Wdfy1 Rat acrylamide decreases expression ISO Wdfy1 (Mus musculus) 6480464 Acrylamide results in decreased expression of WDFY1 mRNA CTD PMID:35032568 Wdfy1 Rat aflatoxin B1 increases expression ISO Wdfy1 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of WDFY1 mRNA CTD PMID:19770486 Wdfy1 Rat aflatoxin B1 increases methylation ISO WDFY1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of WDFY1 exon and Aflatoxin B1 results in increased methylation of WDFY1 intron CTD PMID:30157460 Wdfy1 Rat Aflatoxin B2 alpha increases methylation ISO WDFY1 (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of WDFY1 exon CTD PMID:30157460 Wdfy1 Rat arsenite(3-) multiple interactions ISO WDFY1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to WDFY1 mRNA] CTD PMID:32406909 Wdfy1 Rat benzo[a]pyrene increases methylation ISO WDFY1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of WDFY1 promoter CTD PMID:27901495 Wdfy1 Rat benzo[e]pyrene increases methylation ISO WDFY1 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of WDFY1 exon CTD PMID:30157460 Wdfy1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Wdfy1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of WDFY1 mRNA CTD PMID:33754040 Wdfy1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of WDFY1 mRNA CTD PMID:25181051 Wdfy1 Rat bisphenol A decreases expression ISO WDFY1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of WDFY1 protein CTD PMID:31675489 Wdfy1 Rat bisphenol A increases expression ISO WDFY1 (Homo sapiens) 6480464 bisphenol A results in increased expression of WDFY1 mRNA CTD PMID:29275510 Wdfy1 Rat Bisphenol B increases expression ISO WDFY1 (Homo sapiens) 6480464 bisphenol B results in increased expression of WDFY1 protein CTD PMID:34186270 Wdfy1 Rat bisphenol F decreases expression ISO Wdfy1 (Mus musculus) 6480464 bisphenol F results in decreased expression of WDFY1 mRNA CTD PMID:38685157 Wdfy1 Rat cadmium atom multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of WDFY1 mRNA CTD PMID:35301059 Wdfy1 Rat cadmium dichloride multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of WDFY1 mRNA CTD PMID:35301059 Wdfy1 Rat caffeine increases phosphorylation ISO WDFY1 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of WDFY1 protein CTD PMID:35688186 Wdfy1 Rat carbon nanotube decreases expression ISO Wdfy1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Wdfy1 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of WDFY1 mRNA CTD PMID:23125180 Wdfy1 Rat choline multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of WDFY1 mRNA CTD PMID:20938992 Wdfy1 Rat cyclosporin A increases expression ISO WDFY1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of WDFY1 mRNA CTD PMID:25562108 Wdfy1 Rat decabromodiphenyl ether decreases expression ISO WDFY1 (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of WDFY1 protein CTD PMID:31675489 Wdfy1 Rat Dibutyl phosphate affects expression ISO WDFY1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of WDFY1 mRNA CTD PMID:37042841 Wdfy1 Rat disodium selenite decreases expression ISO WDFY1 (Homo sapiens) 6480464 Sodium Selenite results in decreased expression of WDFY1 mRNA CTD PMID:18175754 Wdfy1 Rat dorsomorphin multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Wdfy1 Rat doxorubicin decreases expression ISO WDFY1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of WDFY1 mRNA CTD PMID:29803840 Wdfy1 Rat ethanol affects splicing ISO Wdfy1 (Mus musculus) 6480464 Ethanol affects the splicing of WDFY1 mRNA CTD PMID:30319688 Wdfy1 Rat ethyl methanesulfonate increases expression ISO WDFY1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of WDFY1 mRNA CTD PMID:23649840 Wdfy1 Rat fipronil increases expression EXP 6480464 fipronil results in increased expression of WDFY1 mRNA CTD PMID:34044035 Wdfy1 Rat folic acid multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [1 more ... CTD PMID:20938992 and PMID:22206623 Wdfy1 Rat formaldehyde increases expression ISO WDFY1 (Homo sapiens) 6480464 Formaldehyde results in increased expression of WDFY1 mRNA CTD PMID:23649840 Wdfy1 Rat FR900359 decreases phosphorylation ISO WDFY1 (Homo sapiens) 6480464 FR900359 results in decreased phosphorylation of WDFY1 protein CTD PMID:37730182 Wdfy1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of WDFY1 mRNA CTD PMID:33387578 Wdfy1 Rat irinotecan affects expression EXP 6480464 Irinotecan affects the expression of WDFY1 mRNA CTD PMID:20097248 Wdfy1 Rat ivermectin decreases expression ISO WDFY1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of WDFY1 protein CTD PMID:32959892 Wdfy1 Rat L-methionine multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of WDFY1 mRNA CTD PMID:20938992 Wdfy1 Rat methapyrilene increases methylation ISO WDFY1 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of WDFY1 exon CTD PMID:30157460 Wdfy1 Rat methyl methanesulfonate increases expression ISO WDFY1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of WDFY1 mRNA CTD PMID:23649840 Wdfy1 Rat methylmercury chloride decreases expression ISO WDFY1 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of WDFY1 mRNA CTD PMID:28001369 Wdfy1 Rat ozone multiple interactions ISO Wdfy1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of WDFY1 mRNA and IL10 gene mutant form promotes the reaction [Ozone results in increased expression of WDFY1 mRNA] CTD PMID:20826374 and PMID:34911549 Wdfy1 Rat ozone multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased oxidation of WDFY1 mRNA CTD PMID:32845096 Wdfy1 Rat ozone increases expression ISO Wdfy1 (Mus musculus) 6480464 Ozone results in increased expression of WDFY1 mRNA CTD PMID:20826374 Wdfy1 Rat paracetamol affects expression ISO Wdfy1 (Mus musculus) 6480464 Acetaminophen affects the expression of WDFY1 mRNA CTD PMID:17562736 Wdfy1 Rat phenobarbital affects expression ISO Wdfy1 (Mus musculus) 6480464 Phenobarbital affects the expression of WDFY1 mRNA CTD PMID:23091169 Wdfy1 Rat phenylmercury acetate decreases expression ISO WDFY1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of WDFY1 mRNA CTD PMID:26272509 Wdfy1 Rat phenylmercury acetate multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of WDFY1 mRNA CTD PMID:27188386 Wdfy1 Rat poly(vinylpyrrolidone) multiple interactions EXP 6480464 [Silver analog co-treated with Povidone] results in increased expression of WDFY1 mRNA CTD PMID:25194297 Wdfy1 Rat protein kinase inhibitor multiple interactions ISO WDFY1 (Homo sapiens) 6480464 Protein Kinase Inhibitors inhibits the reaction [gardiquimod results in increased expression of WDFY1 mRNA] CTD PMID:28003376 Wdfy1 Rat quercetin decreases expression ISO WDFY1 (Homo sapiens) 6480464 Quercetin results in decreased expression of WDFY1 mRNA CTD PMID:21632981 Wdfy1 Rat resveratrol multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of WDFY1 mRNA CTD PMID:23557933 Wdfy1 Rat SB 431542 multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Wdfy1 Rat silver atom multiple interactions EXP 6480464 [Silver analog co-treated with Povidone] results in increased expression of WDFY1 mRNA CTD PMID:25194297 Wdfy1 Rat silver(0) multiple interactions EXP 6480464 [Silver analog co-treated with Povidone] results in increased expression of WDFY1 mRNA CTD PMID:25194297 Wdfy1 Rat sodium arsenite increases expression ISO WDFY1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of WDFY1 mRNA CTD PMID:25879800 Wdfy1 Rat sunitinib increases expression ISO WDFY1 (Homo sapiens) 6480464 Sunitinib results in increased expression of WDFY1 mRNA CTD PMID:31533062 Wdfy1 Rat titanium dioxide decreases methylation ISO Wdfy1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of WDFY1 gene CTD PMID:35295148 Wdfy1 Rat titanium dioxide decreases expression ISO Wdfy1 (Mus musculus) 6480464 titanium dioxide results in decreased expression of WDFY1 mRNA CTD PMID:35295148 Wdfy1 Rat trichostatin A decreases expression ISO WDFY1 (Homo sapiens) 6480464 trichostatin A results in decreased expression of WDFY1 mRNA CTD PMID:24935251 and PMID:26272509 Wdfy1 Rat trichostatin A multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of WDFY1 mRNA CTD PMID:27188386 Wdfy1 Rat valproic acid increases expression ISO WDFY1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of WDFY1 mRNA CTD PMID:19101580 Wdfy1 Rat valproic acid multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of WDFY1 mRNA CTD PMID:27188386 Wdfy1 Rat valproic acid decreases expression ISO WDFY1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of WDFY1 mRNA CTD PMID:23179753 more ... Wdfy1 Rat valproic acid affects expression ISO WDFY1 (Homo sapiens) 6480464 Valproic Acid affects the expression of WDFY1 mRNA CTD PMID:25979313 Wdfy1 Rat venlafaxine hydrochloride increases expression EXP 6480464 Venlafaxine Hydrochloride results in increased expression of WDFY1 mRNA CTD PMID:25423262 Wdfy1 Rat vorinostat multiple interactions ISO WDFY1 (Homo sapiens) 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of WDFY1 mRNA CTD PMID:27188386 Wdfy1 Rat vorinostat decreases expression ISO WDFY1 (Homo sapiens) 6480464 vorinostat results in decreased expression of WDFY1 mRNA CTD PMID:26272509 and PMID:27188386
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,4-methylenedioxymethamphetamine (EXP,ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) acrolein (ISO) acrylamide (ISO) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) Bisphenol B (ISO) bisphenol F (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) carbon nanotube (ISO) chloroprene (EXP) choline (ISO) cyclosporin A (ISO) decabromodiphenyl ether (ISO) Dibutyl phosphate (ISO) disodium selenite (ISO) dorsomorphin (ISO) doxorubicin (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fipronil (EXP) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) gentamycin (EXP) irinotecan (EXP) ivermectin (ISO) L-methionine (ISO) methapyrilene (ISO) methyl methanesulfonate (ISO) methylmercury chloride (ISO) ozone (ISO) paracetamol (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) poly(vinylpyrrolidone) (EXP) protein kinase inhibitor (ISO) quercetin (ISO) resveratrol (ISO) SB 431542 (ISO) silver atom (EXP) silver(0) (EXP) sodium arsenite (ISO) sunitinib (ISO) titanium dioxide (ISO) trichostatin A (ISO) valproic acid (ISO) venlafaxine hydrochloride (EXP) vorinostat (ISO)
Wdfy1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 88,459,613 - 88,541,215 (-) NCBI GRCr8 mRatBN7.2 9 81,034,852 - 81,092,823 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 81,034,849 - 81,092,775 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 89,464,594 - 89,522,539 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 94,593,490 - 94,651,433 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 92,976,004 - 93,033,955 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 85,477,070 - 85,528,885 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 85,475,841 - 85,528,869 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 85,228,597 - 85,280,673 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 79,010,150 - 79,059,470 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 79,193,571 - 79,242,889 (-) NCBI Celera 9 78,532,988 - 78,582,544 (-) NCBI Celera Cytogenetic Map 9 q34 NCBI
WDFY1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 223,875,348 - 223,945,335 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 223,855,716 - 223,945,357 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 224,740,065 - 224,810,052 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 224,448,309 - 224,518,296 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 224,565,569 - 224,635,557 NCBI Celera 2 218,505,977 - 218,575,969 (-) NCBI Celera Cytogenetic Map 2 q36.1 NCBI HuRef 2 216,592,701 - 216,661,805 (-) NCBI HuRef CHM1_1 2 224,746,548 - 224,816,548 (-) NCBI CHM1_1 T2T-CHM13v2.0 2 224,358,556 - 224,428,591 (-) NCBI T2T-CHM13v2.0
Wdfy1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 79,679,979 - 79,753,764 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 79,679,979 - 79,753,860 (-) Ensembl GRCm39 Ensembl GRCm38 1 79,702,262 - 79,776,143 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 79,702,262 - 79,776,143 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 79,698,837 - 79,758,344 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 79,605,440 - 79,640,756 (-) NCBI MGSCv36 mm8 Celera 1 79,790,257 - 79,790,462 (-) NCBI Celera Cytogenetic Map 1 C4 NCBI cM Map 1 40.94 NCBI
Wdfy1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955453 10,101,576 - 10,149,710 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955453 10,101,576 - 10,148,205 (+) NCBI ChiLan1.0 ChiLan1.0
WDFY1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 13 126,466,931 - 126,564,889 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2B 126,509,926 - 126,579,858 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2B 111,121,073 - 111,190,968 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2B 229,697,353 - 229,767,308 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2B 229,697,353 - 229,767,308 (-) Ensembl panpan1.1 panPan2
WDFY1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 37 29,544,956 - 29,658,544 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 37 29,444,082 - 29,677,312 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 37 30,395,512 - 30,511,040 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 37 29,584,614 - 29,700,361 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 37 29,570,379 - 29,700,372 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 37 29,565,490 - 29,610,275 (-) NCBI UMICH_Zoey_3.1 UMICH_Zoey_3.1 37 29,494,822 - 29,546,540 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 37 29,429,613 - 29,546,246 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 37 29,439,312 - 29,557,601 (-) NCBI UU_Cfam_GSD_1.0
LOC101955400 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 179,147,492 - 179,262,826 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936569 5,575,961 - 5,604,970 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 Ensembl NW_004936569 5,490,319 - 5,544,250 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936569 5,574,591 - 5,604,948 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
WDFY1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 125,669,842 - 125,720,158 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 125,674,142 - 125,720,187 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 139,069,876 - 139,081,534 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
WDFY1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 109,815,043 - 109,889,120 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 109,818,422 - 109,889,023 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 89,515,457 - 89,583,083 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Wdfy1
.
Predicted Target Of
Count of predictions: 55 Count of miRNA genes: 50 Interacting mature miRNAs: 54 Transcripts: ENSRNOT00000063834 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
11353957 Bmd92 Bone mineral density QTL 92 0.01 tibia mineral mass (VT:1000283) volumetric bone mineral density (CMO:0001553) 9 46114199 91114199 Rat 724547 Cm21 Cardiac mass QTL 21 2.7 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 9 79271511 102910209 Rat 61385 Edpm9 Estrogen-dependent pituitary mass QTL 9 3.43 0.05 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 9 63869687 108869687 Rat 724544 Uae9 Urinary albumin excretion QTL 9 4.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 9 25268044 114175309 Rat 1578760 Cm53 Cardiac mass QTL 53 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 9 56771635 101771635 Rat 1581580 Uae34 Urinary albumin excretion QTL 34 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 62072275 96470995 Rat 12879506 Pur33 Proteinuria QTL 33 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 44649921 89649921 Rat 1354626 Bvd1 Brain ventricular dilatation QTL 1 3.73 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 9 75712843 111552878 Rat 7794784 Mcs31 Mammary carcinoma susceptibility QTL 31 2.98 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 9 77813894 111552878 Rat 731164 Uae25 Urinary albumin excretion QTL 25 3.5 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 25661188 100929786 Rat 10058949 Gmadr5 Adrenal mass QTL 5 2 0.014 adrenal gland mass (VT:0010420) both adrenal glands wet weight to body weight ratio (CMO:0002411) 9 42791513 87976209 Rat 1578757 Pur6 Proteinuria QTL 6 3.3 0.005 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 62072275 96470995 Rat 631656 Bp108 Blood pressure QTL 108 5.97 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 48598251 93598251 Rat 8662828 Vetf6 Vascular elastic tissue fragility QTL 6 3.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 9 36962359 92058970 Rat 724515 Uae16 Urinary albumin excretion QTL 16 8 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 58163035 100929646 Rat 731171 Glom6 Glomerulus QTL 6 2.8 0.0003 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) 9 64573531 109573531 Rat 2303178 Bp334 Blood pressure QTL 334 3.7 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 79271511 91616855 Rat 70186 Niddm26 Non-insulin dependent diabetes mellitus QTL 26 3.87 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 9 22071169 86369743 Rat 7207814 Bmd91 Bone mineral density QTL 91 3.5 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 9 23754144 83851531 Rat 6903941 Pur31 Proteinuria QTL 31 0.036 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 9 40194188 85194188 Rat 2290450 Scl57 Serum cholesterol level QTL 57 4.15 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 9 36962359 95410867 Rat 11353949 Bp393 Blood pressure QTL 393 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 40194188 85194188 Rat 11353951 Bp394 Blood pressure QTL 394 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 44649921 89649921 Rat 10054125 Srcrt7 Stress Responsive Cort QTL 7 3.33 0.0011 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 9 1 87073594 Rat 1300134 Bp185 Blood pressure QTL 185 3.73 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 9 61381434 104821652 Rat 4889852 Pur26 Proteinuria QTL 26 15 0.001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 77813894 101597663 Rat
D9Got93
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 9 81,049,932 - 81,050,077 (+) MAPPER mRatBN7.2 Rnor_6.0 9 85,486,167 - 85,486,311 NCBI Rnor6.0 Rnor_5.0 9 85,237,694 - 85,237,838 UniSTS Rnor5.0 RGSC_v3.4 9 79,016,342 - 79,016,487 RGD RGSC3.4 RGSC_v3.4 9 79,016,343 - 79,016,487 UniSTS RGSC3.4 RGSC_v3.1 9 79,199,762 - 79,199,906 RGD Celera 9 78,538,758 - 78,538,902 UniSTS RH 3.4 Map 9 737.3 UniSTS RH 3.4 Map 9 737.3 RGD RH 2.0 Map 9 821.4 RGD Cytogenetic Map 9 q34 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000063834 ⟹ ENSRNOP00000062993
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 9 81,056,556 - 81,092,775 (-) Ensembl Rnor_6.0 Ensembl 9 85,479,996 - 85,528,860 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000088963 ⟹ ENSRNOP00000072691
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 9 81,034,849 - 81,092,775 (-) Ensembl Rnor_6.0 Ensembl 9 85,475,841 - 85,528,869 (-) Ensembl
RefSeq Acc Id:
NM_001393984 ⟹ NP_001380913
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,489,227 - 88,541,186 (-) NCBI mRatBN7.2 9 81,040,833 - 81,092,794 (-) NCBI
RefSeq Acc Id:
NR_172063
RefSeq Status:
VALIDATED
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,489,227 - 88,541,186 (-) NCBI mRatBN7.2 9 81,040,833 - 81,092,794 (-) NCBI
RefSeq Acc Id:
NR_172064
RefSeq Status:
VALIDATED
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,483,246 - 88,541,186 (-) NCBI mRatBN7.2 9 81,034,852 - 81,092,794 (-) NCBI
RefSeq Acc Id:
XM_063266996 ⟹ XP_063123066
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,469,596 - 88,541,215 (-) NCBI
RefSeq Acc Id:
XM_063266997 ⟹ XP_063123067
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,469,596 - 88,541,215 (-) NCBI
RefSeq Acc Id:
XM_063266998 ⟹ XP_063123068
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,459,613 - 88,541,215 (-) NCBI
RefSeq Acc Id:
XR_010054584
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,459,613 - 88,541,215 (-) NCBI
RefSeq Acc Id:
XR_010054585
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,469,596 - 88,541,215 (-) NCBI
RefSeq Acc Id:
XR_357088
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 88,493,123 - 88,541,215 (-) NCBI mRatBN7.2 9 81,040,833 - 81,092,823 (-) NCBI Rnor_6.0 9 85,477,070 - 85,528,885 (-) NCBI Rnor_5.0 9 85,228,597 - 85,280,673 (-) NCBI
Sequence:
CCGGCGCGTCCCCGCCCGGCGGTCAGCTGATGGGCCGCCCGCGGGGGAGGCCGCGGCTCGAACATGGCGGCCGAGATCCACTCCAGGCCGCAGAGCAGCCGCCCGGTGCTGCTGAGCAAGATTGAGGG
hide sequence
Ensembl Acc Id:
ENSRNOP00000062993 ⟸ ENSRNOT00000063834
Ensembl Acc Id:
ENSRNOP00000072691 ⟸ ENSRNOT00000088963
RefSeq Acc Id:
NP_001380913 ⟸ NM_001393984
- UniProtKB:
A0A0G2K3L8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063123068 ⟸ XM_063266998
- Peptide Label:
isoform X1
- UniProtKB:
A0A0G2K3L8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063123067 ⟸ XM_063266997
- Peptide Label:
isoform X1
- UniProtKB:
A0A0G2K3L8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063123066 ⟸ XM_063266996
- Peptide Label:
isoform X1
- UniProtKB:
A0A0G2K3L8 (UniProtKB/TrEMBL)
RGD ID: 13696792 Promoter ID: EPDNEW_R7316 Type: initiation region Name: Wdfy1_1 Description: WD repeat and FYVE domain containing 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 9 85,528,830 - 85,528,890 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Wdfy1
WD repeat and FYVE domain containing 1
LOC108351959
uncharacterized LOC108351959
Data merged from RGD:11424453
737654 PROVISIONAL
2016-08-02
LOC108351959
uncharacterized LOC108351959
Symbol and Name status set to provisional
70820 PROVISIONAL
2005-12-06
Wdfy1
WD repeat and FYVE domain containing 1
Wdfy1_predicted
WD repeat and FYVE domain containing 1 (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Wdfy1_predicted
WD repeat and FYVE domain containing 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
