Symbol:
Hif1an
Name:
hypoxia inducible factor 1 subunit alpha inhibitor
RGD ID:
1308281
Description:
Predicted to enable several functions, including 2-oxoglutarate-dependent dioxygenase activity; NF-kappaB binding activity; and transition metal ion binding activity. Predicted to be involved in negative regulation of Notch signaling pathway; positive regulation of myoblast differentiation; and regulation of vascular endothelial growth factor receptor signaling pathway. Predicted to be located in cytosol; nucleoplasm; and perinuclear region of cytoplasm. Predicted to be active in cytoplasm and nucleus. Orthologous to human HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor); PARTICIPATES IN hypoxia inducible factor pathway; INTERACTS WITH 17alpha-ethynylestradiol; 2,2',5,5'-tetrachlorobiphenyl; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
hypoxia-inducible factor 1, alpha subunit inhibitor; hypoxia-inducible factor 1-alpha inhibitor; LOC309434
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, Treefam
Mus musculus (house mouse):
Hif1an (hypoxia-inducible factor 1, alpha subunit inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Hif1an (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Hif1an (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Hif1an (hypoxia inducible factor 1 subunit alpha inhibitor) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
HIF1AN (hypoxia inducible factor 1 subunit alpha inhibitor)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Hif1an (hypoxia-inducible factor 1, alpha subunit inhibitor)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
hif1an (hypoxia inducible factor 1 subunit alpha inhibitor)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
hif1an
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 253,368,400 - 253,385,495 (+) NCBI GRCr8 mRatBN7.2 1 243,419,175 - 243,440,464 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 243,419,194 - 243,434,327 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 251,564,114 - 251,578,965 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 258,265,303 - 258,276,602 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 250,914,313 - 250,928,924 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 264,309,214 - 264,319,269 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 264,309,214 - 264,319,267 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 271,752,379 - 271,762,022 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 249,607,945 - 249,618,000 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 249,868,052 - 249,878,559 (+) NCBI Celera 1 239,233,319 - 239,243,566 (+) NCBI Celera Cytogenetic Map 1 q54 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - PID (archival)
Molecular Function
[protein]-asparagine 3-dioxygenase activity (IBA,IEA,ISO) ankyrin repeat binding (IEA,ISO) carboxylic acid binding (IEA,ISO) ferrous iron binding (IEA,ISO) NF-kappaB binding (IEA,ISO) Notch binding (IEA,ISO) peptidyl-aspartic acid 3-dioxygenase activity (IEA,ISO) peptidyl-histidine dioxygenase activity (IBA,IEA,ISO) protein binding (ISO) protein homodimerization activity (IEA,ISO) RNA polymerase II-specific DNA-binding transcription factor binding (ISO) transcription corepressor activity (IEA,ISO) zinc ion binding (IEA,ISO)
Hif1an Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 253,368,400 - 253,385,495 (+) NCBI GRCr8 mRatBN7.2 1 243,419,175 - 243,440,464 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 243,419,194 - 243,434,327 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 251,564,114 - 251,578,965 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 258,265,303 - 258,276,602 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 250,914,313 - 250,928,924 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 264,309,214 - 264,319,269 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 264,309,214 - 264,319,267 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 271,752,379 - 271,762,022 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 249,607,945 - 249,618,000 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 249,868,052 - 249,878,559 (+) NCBI Celera 1 239,233,319 - 239,243,566 (+) NCBI Celera Cytogenetic Map 1 q54 NCBI
HIF1AN Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 10 100,535,943 - 100,559,998 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 10 100,529,072 - 100,559,998 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 10 102,295,700 - 102,319,755 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 10 102,285,631 - 102,303,671 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 10 102,285,685 - 102,299,745 NCBI Celera 10 96,033,472 - 96,051,511 (+) NCBI Celera Cytogenetic Map 10 q24.31 NCBI HuRef 10 95,924,437 - 95,942,312 (+) NCBI HuRef CHM1_1 10 102,580,289 - 102,598,327 (+) NCBI CHM1_1 T2T-CHM13v2.0 10 101,419,020 - 101,443,061 (+) NCBI T2T-CHM13v2.0
Hif1an Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 19 44,551,293 - 44,564,713 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 19 44,551,289 - 44,564,713 (+) Ensembl GRCm39 Ensembl GRCm38 19 44,562,854 - 44,576,274 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 19 44,562,850 - 44,576,274 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 19 44,637,344 - 44,650,764 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 19 44,616,165 - 44,629,585 (+) NCBI MGSCv36 mm8 Celera 19 45,330,539 - 45,343,961 (+) NCBI Celera Cytogenetic Map 19 C3 NCBI cM Map 19 37.98 NCBI
Hif1an Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955485 9,592,106 - 9,602,019 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955485 9,592,106 - 9,602,019 (-) NCBI ChiLan1.0 ChiLan1.0
HIF1AN Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 8 112,419,630 - 112,437,585 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 10 112,424,952 - 112,442,905 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 10 97,135,751 - 97,148,378 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 10 100,616,208 - 100,634,201 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 10 100,616,208 - 100,628,470 (+) Ensembl panpan1.1 panPan2
HIF1AN Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 28 13,253,646 - 13,277,997 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 28 13,258,765 - 13,267,608 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 28 13,424,601 - 13,448,956 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 28 13,722,856 - 13,747,207 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 28 13,727,221 - 13,747,201 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 28 13,269,337 - 13,293,495 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 28 13,310,952 - 13,335,114 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 28 13,441,952 - 13,472,609 (+) NCBI UU_Cfam_GSD_1.0
Hif1an
HIF1AN Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 111,636,376 - 111,650,318 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 111,636,317 - 111,654,659 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 121,295,774 - 121,311,992 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
HIF1AN Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 9 93,557,143 - 93,569,301 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 9 93,557,055 - 93,569,035 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 54,605,396 - 54,623,074 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Hif1an
.
Predicted Target Of
Count of predictions: 44 Count of miRNA genes: 40 Interacting mature miRNAs: 43 Transcripts: ENSRNOT00000019070 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1578778 Pur4 Proteinuria QTL 4 3.3 0.003 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 1 150700247 252085048 Rat 1354646 Kidm18 Kidney mass QTL 18 5.7 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 256448636 Rat 631690 Scl5 Serum cholesterol level QTL 5 2.1 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 1 236125214 260522016 Rat 1354652 Kidm20 Kidney mass QTL 20 4.3 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 177227632 256448636 Rat 2293674 Bss39 Bone structure and strength QTL 39 7.1 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 1 201554356 246554356 Rat 2302378 Insul11 Insulin level QTL 11 3.25 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 144267353 251128347 Rat 61327 Eae7 Experimental allergic encephalomyelitis QTL 7 5.6 body mass (VT:0001259) change in body weight (CMO:0002045) 1 216255568 260522016 Rat 1600392 Bw123 Body weight QTL 123 0.001 body mass (VT:0001259) body weight (CMO:0000012) 1 223201027 260522016 Rat 1578763 Kidm29 Kidney mass QTL 29 3.3 0.0001 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 1 179567751 260522016 Rat 1600395 Niddm69 Non-insulin dependent diabetes mellitus QTL 69 4.14 0.0002 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 195804352 257091168 Rat 1354624 Cm35 Cardiac mass QTL35 5.7 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 177227632 256448636 Rat 1600396 Niddm68 Non-insulin dependent diabetes mellitus QTL 68 4.97 0.0003 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 631837 Niddm35 Non-insulin dependent diabetes mellitus QTL 35 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 238699859 259647894 Rat 1600397 Edcs4 Endometrial carcinoma susceptibility QTL 4 2.2 uterus morphology trait (VT:0001120) percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759) 1 206081677 251081677 Rat 631836 Stl31 Serum triglyceride level QTL 31 4.64 5e-06 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 1 237147813 260522016 Rat 1549837 Hcar15 Hepatocarcinoma resistance QTL 15 0.05 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 153136852 260522016 Rat 1600388 Niddm67 Non-insulin dependent diabetes mellitus QTL 67 5.84 0.000004 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 2293694 Bss38 Bone structure and strength QTL 38 7.05 0.0001 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 1 201554356 246554356 Rat 1578759 Uae30 Urinary albumin excretion QTL 30 3.3 0.003 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 150700247 252085048 Rat 1300108 Rf8 Renal function QTL 8 3.75 renal blood flow trait (VT:2000006) absolute change in renal vascular resistance (CMO:0001900) 1 228581588 259647894 Rat 8655655 Arrd2 Age-related retinal degeneration QTL 2 7.79 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 183970203 243914901 Rat 734767 Niddm57 Non-insulin dependent diabetes mellitus QTL 57 body mass (VT:0001259) body weight (CMO:0000012) 1 224054293 260122809 Rat 1358898 Bp255 Blood pressure QTL 255 3.6 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 191019702 246062233 Rat 631215 Stl8 Serum triglyceride level QTL 8 9.27 0.0001 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 1 225126575 260522016 Rat 631843 Bw116 Body weight QTL 116 4.1 0.016 abdominal adipose amount (VT:1000220) abdominal fat pad weight (CMO:0000088) 1 224054293 260122809 Rat 2300175 Bmd40 Bone mineral density QTL 40 15.4 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 1 201554356 246554356 Rat 731175 Uae20 Urinary albumin excretion QTL 20 3.5 0.0018 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 221264111 259647894 Rat 1354661 Bw33 Body weight QTL 33 5.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 724538 Kidm1 Kidney mass QTL 1 3.2 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 213707201 252085212 Rat 2293655 Bss36 Bone structure and strength QTL 36 10.66 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 201554356 246554356 Rat 724531 Uae5 Urinary albumin excretion QTL 5 4 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 1 150700142 252085212 Rat 734769 Niddm58 Non-insulin dependent diabetes mellitus QTL 58 body mass (VT:0001259) body weight (CMO:0000012) 1 224569538 260122809 Rat 734768 Niddm59 Non-insulin dependent diabetes mellitus QTL 59 body mass (VT:0001259) body weight (CMO:0000012) 1 213843987 258843987 Rat 1358890 Bp259 Blood pressure QTL 259 3.06 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 210702053 260522016 Rat 724533 Rf51 Renal function QTL 51 5.3 0.0002 kidney plasma flow trait (VT:0005524) renal plasma flow (CMO:0001914) 1 218753816 256448513 Rat 1354580 Scort1 Serum corticosterone level QTL 1 3.4 blood corticosterone amount (VT:0005345) blood corticosterone level (CMO:0001172) 1 156677124 256448636 Rat 634313 Niddm43 Non-insulin dependent diabetes mellitus QTL 43 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 199050459 259647894 Rat 1549910 Bw54 Body weight QTL 54 0.05 body mass (VT:0001259) body weight (CMO:0000012) 1 214647894 259647894 Rat 70211 Niddm24 Non-insulin dependent diabetes mellitus QTL 24 3.79 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 214647894 259647894 Rat 1357399 Bw45 Body weight QTL 45 3.05 body mass (VT:0001259) body mass index (BMI) (CMO:0000105) 1 206329708 251329708 Rat 724552 Glom2 Glomerulus QTL 2 3.3 0.0001 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli directly contacting the kidney surface (CMO:0001001) 1 222363780 260522016 Rat 2316896 Gluco57 Glucose level QTL 57 7.2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 228985440 245907899 Rat 1357404 Bw42 Body weight QTL 42 4.49 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 1 206329708 251329708 Rat 10053715 Scort24 Serum corticosterone level QTL 24 2.13 0.0088 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 221414816 260522016 Rat 61400 Niddm1 Non-insulin dependent diabetes mellitus QTL 1 11 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 218753689 245907899 Rat 10059587 Bw173 Body weight QTL 173 3.23 0.025 body mass (VT:0001259) body weight (CMO:0000012) 1 202069611 247069611 Rat 2292216 Bw80 Body weight QTL 80 3.23 0.0019 body mass (VT:0001259) body weight (CMO:0000012) 1 213533809 243914901 Rat 2292220 Bp306 Blood pressure QTL 306 3.47 0.00087 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 243914901 Rat 1354610 Bw34 Body weight QTL 34 4.1 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 2293700 Bmd27 Bone mineral density QTL 27 6.6 0.0001 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 1 224054293 243747962 Rat 2293701 Bmd34 Bone mineral density QTL 34 8.3 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 1 224054293 243747962 Rat 7387289 Uae45 Urinary albumin excretion QTL 45 2.86 0.0021 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 223262787 260522016 Rat 8655855 Arrd3 Age-related retinal degeneration QTL 3 3.07 lens clarity trait (VT:0001304) cataract incidence/prevalence measurement (CMO:0001585) 1 183970203 243914901 Rat 1581544 Rf52 Renal function QTL 52 0.05 urine total protein amount (VT:0000032) urine protein excretion rate to body weight ratio (CMO:0001099) 1 232156370 259647894 Rat 1600363 Hc6 Hypercalciuria QTL 6 2.7 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 203995416 244113296 Rat 631536 Lnnr2 Liver neoplastic nodule remodeling QTL 2 2.9 0.0005 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705) 1 233948574 260522016 Rat 738032 Hcas5 Hepatocarcinoma susceptibility QTL 5 3.12 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 176426412 257976495 Rat 1358191 Ept10 Estrogen-induced pituitary tumorigenesis QTL 10 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 192825253 243914732 Rat 2302040 Pia35 Pristane induced arthritis QTL 35 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 216255568 260522016 Rat 631669 Iddm9 Insulin dependent diabetes mellitus QTL 9 2.8 0.039 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 1 233190394 258625266 Rat 7394701 Uae46 Urinary albumin excretion QTL 46 3.6 0.0056 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 201554356 246554356 Rat 1598821 Rf55 Renal function QTL 55 6.3 renal blood flow trait (VT:2000006) ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239) 1 218748008 257976495 Rat
Hif1an
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 243,419,727 - 243,419,862 (+) MAPPER mRatBN7.2 Rnor_6.0 1 264,309,738 - 264,309,872 NCBI Rnor6.0 Rnor_5.0 1 271,752,903 - 271,753,037 UniSTS Rnor5.0 Celera 1 239,233,843 - 239,233,977 UniSTS Cytogenetic Map 1 q54 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000019070 ⟹ ENSRNOP00000019070
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 243,419,194 - 243,427,254 (+) Ensembl Rnor_6.0 Ensembl 1 264,309,214 - 264,319,267 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000114444 ⟹ ENSRNOP00000078637
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 243,419,210 - 243,434,327 (+) Ensembl
RefSeq Acc Id:
NM_001113749 ⟹ NP_001107221
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 253,368,424 - 253,380,665 (+) NCBI mRatBN7.2 1 243,419,204 - 243,431,445 (+) NCBI Rnor_6.0 1 264,309,214 - 264,319,269 (+) NCBI Rnor_5.0 1 271,752,379 - 271,762,022 (+) NCBI RGSC_v3.4 1 249,607,945 - 249,618,000 (+) RGD Celera 1 239,233,319 - 239,243,566 (+) RGD
Sequence:
CTAGAGTAGAGATGGCGGCGACGGCAGCCGAGGTTGCGGCCTCTGCCTCTGGAGAGGCCCGGGAAGAAGCTGAAGCTCCGGGCCCGGCCTGGGATGAGTCCCAGCTACGAAGTTACAGCTTTCCGACC
hide sequence
RefSeq Acc Id:
XM_039080364 ⟹ XP_038936292
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 253,368,400 - 253,385,495 (+) NCBI mRatBN7.2 1 243,419,175 - 243,440,464 (+) NCBI
RefSeq Acc Id:
NP_001107221 ⟸ NM_001113749
- UniProtKB:
B0BNG5 (UniProtKB/TrEMBL), A0A8I6G3J3 (UniProtKB/TrEMBL), F7F9I0 (UniProtKB/TrEMBL)
- Sequence:
MAATAAEVAASASGEAREEAEAPGPAWDESQLRSYSFPTRPIPRLSQSDPRAEELIENEEPVVLTDTNLVYPALKWDLEYLQENIGNGDFSVYSASTHKFLYYDEKKMANFQNFKPRSNREEIKFHEF
hide sequence
Ensembl Acc Id:
ENSRNOP00000019070 ⟸ ENSRNOT00000019070
RefSeq Acc Id:
XP_038936292 ⟸ XM_039080364
- Peptide Label:
isoform X1
- UniProtKB:
F7F9I0 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000078637 ⟸ ENSRNOT00000114444
RGD ID: 13690941 Promoter ID: EPDNEW_R1466 Type: multiple initiation site Name: Hif1an_1 Description: hypoxia-inducible factor 1, alpha subunit inhibitor SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 264,309,207 - 264,309,267 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2018-05-25
Hif1an
hypoxia inducible factor 1 subunit alpha inhibitor
Hif1an
hypoxia-inducible factor 1, alpha subunit inhibitor
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Hif1an
hypoxia-inducible factor 1, alpha subunit inhibitor
Hif1an_predicted
hypoxia-inducible factor 1, alpha subunit inhibitor (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Hif1an_predicted
hypoxia-inducible factor 1, alpha subunit inhibitor (predicted)
Symbol and Name status set to approved
70820 APPROVED
