Advanced Search (OLGA)

Gene: Mir16-2 (microRNA 16-2) Rattus norvegicus

Analyze

Symbol:

Mir16-2 (Ensembl: Mir16)

Name:

microRNA 16-2 (Ensembl:microRNA 16)

RGD ID:

7488974

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing post-transcriptional repressor activity. Involved in miRNA-mediated post-transcriptional gene silencing and positive regulation of cardiac muscle cell apoptotic process. Predicted to be located in extracellular exosome. Predicted to be part of RISC complex. Orthologous to human MIR16-2 (microRNA 16-2); INTERACTS WITH 1-naphthyl isothiocyanate; 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA 16; Mir16; rno-mir-16

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	2	155,555,327 - 155,555,421 (+)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	2	155,555,327 - 155,555,421 (+)	Ensembl				GRCr8
mRatBN7.2	2	153,245,349 - 153,245,443 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	2	153,245,349 - 153,245,443 (+)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	2	160,375,020 - 160,375,114 (+)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	2	158,425,537 - 158,425,631 (+)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	2	153,058,304 - 153,058,398 (+)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Dahl_SR_JrHsd	2	154,667,417 - 154,667,511 (+)	NCBI		Dahl_SR_JrHsd
Lyon_Normotensive	2	154,986,395 - 154,986,489 (+)	NCBI		Lyon_Normotensive
Lyon_Hypertensive	2	154,614,618 - 154,614,712 (+)	NCBI		Lyon_Hypertensive
F344_StmMcwi	2	154,708,200 - 154,708,294 (+)	NCBI		F344_StmMcwi
Rnor_6.0	2	165,606,072 - 165,606,166 (+)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	2	165,606,072 - 165,606,166 (+)	Ensembl			rn6	Rnor6.0
Celera	2	147,596,149 - 147,596,243 (+)	NCBI		Celera
Cytogenetic Map	2	q32	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1-naphthyl isothiocyanate (EXP)

17alpha-ethynylestradiol (EXP)

2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO)

2,4-dinitrotoluene (EXP)

amiodarone (EXP)

benzene (ISO)

benzo[a]pyrene (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bisphenol A (EXP,ISO)

bleomycin A2 (EXP)

cadmium atom (EXP,ISO)

cadmium dichloride (EXP,ISO)

catechol (ISO)

chloroform (EXP)

cisplatin (EXP)

dexamethasone (EXP)

erythromycin estolate (EXP)

formaldehyde (ISO)

genistein (EXP)

hydrogen peroxide (ISO)

lipopolysaccharide (EXP)

mechlorethamine (EXP)

Muraglitazar (EXP)

N-nitrosodiethylamine (EXP)

naloxone (EXP)

paracetamol (EXP,ISO)

perfluorooctane-1-sulfonic acid (EXP)

phenol (ISO)

pirinixic acid (ISO)

rimonabant (ISO)

sodium fluoride (EXP)

tamoxifen (EXP)

tert-butyl hydroperoxide (ISO)

Tesaglitazar (EXP)

tetrachloromethane (EXP)

tetracycline (EXP)

trichloroethene (EXP)

troglitazone (EXP)

valproic acid (ISO)

vinclozolin (EXP)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

branching involved in blood vessel morphogenesis (ISO)

cellular response to glucose stimulus (ISO)

cellular response to leukemia inhibitory factor (ISO)

cellular response to lipopolysaccharide (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of amyloid-beta formation (ISO)

negative regulation of angiogenesis (ISO)

negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

negative regulation of canonical NF-kappaB signal transduction (ISO)

negative regulation of cell chemotaxis to fibroblast growth factor (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of endothelial cell chemotaxis (ISO)

negative regulation of endothelial cell chemotaxis to fibroblast growth factor (ISO)

negative regulation of endothelial cell proliferation (ISO)

negative regulation of fibroblast growth factor receptor signaling pathway (ISO)

negative regulation of G1/S transition of mitotic cell cycle (ISO)

negative regulation of inflammatory response (ISO)

negative regulation of mesenchymal stem cell proliferation (ISO)

negative regulation of placenta blood vessel development (ISO)

negative regulation of trophoblast cell migration (ISO)

negative regulation of vascular endothelial growth factor production (ISO)

negative regulation of vascular endothelial growth factor signaling pathway (ISO)

ossification (ISO)

positive regulation of apoptotic process (ISO)

positive regulation of intrinsic apoptotic signaling pathway (ISO)

positive regulation of translation (ISO)

regulation of glucosylceramide catabolic process (ISO)

response to bacterium (ISO)

response to oxygen levels (ISO)

response to wounding (ISO)

sensory perception of sound (ISO)

Cellular Component

extracellular exosome (ISO)

extracellular space (ISO)

RISC complex (ISO)

RNAi effector complex (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing post-transcriptional repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:16766679	PMID:17604727	PMID:18723672	PMID:18762567	PMID:19188439	PMID:20403161	PMID:20439489	PMID:20633552	PMID:22052914
PMID:22503104	PMID:23056528	PMID:23646144	PMID:24205035	PMID:25583328	PMID:25751060	PMID:25779937	PMID:26195352	PMID:26293467	PMID:26453808	PMID:26592823	PMID:26628105
PMID:26683117	PMID:26761212	PMID:27770129	PMID:28423616	PMID:29263199	PMID:29402872	PMID:29767235	PMID:31432171	PMID:31777165	PMID:31960969	PMID:32265338	PMID:32411326
PMID:33045023	PMID:33978928	PMID:35501542

Genomics

Comparative Map Data

Mir16-2
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	2	155,555,327 - 155,555,421 (+)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	2	155,555,327 - 155,555,421 (+)	Ensembl				GRCr8
mRatBN7.2	2	153,245,349 - 153,245,443 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	2	153,245,349 - 153,245,443 (+)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	2	160,375,020 - 160,375,114 (+)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	2	158,425,537 - 158,425,631 (+)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	2	153,058,304 - 153,058,398 (+)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Dahl_SR_JrHsd	2	154,667,417 - 154,667,511 (+)	NCBI		Dahl_SR_JrHsd
Lyon_Normotensive	2	154,986,395 - 154,986,489 (+)	NCBI		Lyon_Normotensive
Lyon_Hypertensive	2	154,614,618 - 154,614,712 (+)	NCBI		Lyon_Hypertensive
F344_StmMcwi	2	154,708,200 - 154,708,294 (+)	NCBI		F344_StmMcwi
Rnor_6.0	2	165,606,072 - 165,606,166 (+)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	2	165,606,072 - 165,606,166 (+)	Ensembl			rn6	Rnor6.0
Celera	2	147,596,149 - 147,596,243 (+)	NCBI		Celera
Cytogenetic Map	2	q32	NCBI

MIR16-2
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	3	160,404,745 - 160,404,825 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	3	160,404,745 - 160,404,825 (+)	Ensembl			hg38	GRCh38
GRCh37	3	160,122,533 - 160,122,613 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	3	161,605,226 - 161,605,306 (+)	NCBI	Build 36	Build 36	hg18	NCBI36
Celera	3	158,543,900 - 158,543,980 (+)	NCBI		Celera
Cytogenetic Map	3	q25.33	NCBI
HuRef	3	157,521,115 - 157,521,195 (+)	NCBI		HuRef
CHM1_1	3	160,085,422 - 160,085,502 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	3	163,179,357 - 163,179,437 (+)	NCBI		T2T-CHM13v2.0

Mir16-2
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	3	68,917,235 - 68,917,329 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	3	68,917,235 - 68,917,329 (+)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	3	69,009,902 - 69,009,996 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	3	69,009,902 - 69,009,996 (+)	Ensembl			mm10	GRCm38
MGSCv37	3	68,813,824 - 68,813,918 (+)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
Celera	3	69,117,716 - 69,117,810 (+)	NCBI		Celera
Cytogenetic Map	3	E1	NCBI
cM Map	3	32.15	NCBI

MIR16-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	34	26,460,807 - 26,460,871 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	34	26,460,807 - 26,460,871 (+)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	34	30,502,952 - 30,503,016 (+)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	34	26,517,471 - 26,517,535 (+)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	34	26,517,471 - 26,517,535 (+)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	34	26,447,152 - 26,447,216 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	34	26,407,809 - 26,407,873 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	34	26,647,896 - 26,647,960 (+)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

MIR16-1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	13	100,083,329 - 100,083,405 (+)	Ensembl			susScr11	Sscrofa11.1
Sscrofa11.1	13	100,083,329 - 100,083,405 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	13	108,388,290 - 108,388,366 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir16-2
3 total Variants

miRNA Target Status (No longer updated)

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Bcl2	rno-miR-16-5p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot	Functional MTI	19232449
Arl2	rno-miR-16-5p	Mirtarbase	external_info	Reporter assay;qRT-PCR;Other	Functional MTI	20007690

Predicted Targets

	Summary Value
Count of predictions:	7946
Count of gene targets:	4950
Count of transcripts:	5384
Interacting mature miRNAs:	rno-miR-16-3p, rno-miR-16-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631566	Bp90	Blood pressure QTL 90		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	149957381	221199885	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	44537979	205135428	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	67845370	229470703	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	83465462	229820014	Rat
1298076	Bp166	Blood pressure QTL 166		0.0009	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	138595962	205135428	Rat
10755499	Bp389	Blood pressure QTL 389	2.61		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	20695736	231474293	Rat
1581576	Pur7	Proteinuria QTL 7		0.0001	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	2	80396178	220931218	Rat
1581578	Cm49	Cardiac mass QTL 49	4.9	0.01	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	145807215	220931416	Rat
152025245	Scl81	Serum cholesterol level QTL 81	3.49		blood cholesterol amount (VT:0000180)		2	124537199	209621565	Rat
631198	Cm22	Cardiac mass QTL 22	4.3	0.0008	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	78269809	208420281	Rat
1554319	Bmd2	Bone mineral density QTL 2	13.4	0.0001	lumbar vertebra area (VT:0010570)	lumbar vertebra cross-sectional area (CMO:0001689)	2	122597372	215234002	Rat
12879836	Kidm61	Kidney mass QTL 61		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	154723085	199723085	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	80396178	220931218	Rat
10043136	Iddm54	Insulin dependent diabetes mellitus QTL 54	3.4	0.0001	blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	145807215	190807215	Rat
12879837	Am2	Aortic mass QTL 2		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	2	154723085	199723085	Rat
10043139	Iddm55	Insulin dependent diabetes mellitus QTL 55	3.1	0.0001	blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	150313808	195313808	Rat
12879838	Cm86	Cardiac mass QTL 86		0.002	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	154723085	199723085	Rat
12879839	Cm85	Cardiac mass QTL 85		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	2	154723085	199723085	Rat
1358901	Cm38	Cardiac mass QTL 38	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	27148328	159440891	Rat
12879845	Cm89	Cardiac mass QTL 89		0.008	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	154723085	178247591	Rat
1359030	Bp277	Blood pressure QTL 277			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	143565208	188565208	Rat
12879846	Cm90	Cardiac mass QTL 90		0.011	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	2	154723085	178247591	Rat
12879847	Am4	Aortic mass QTL 4		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	2	154723085	178247591	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	4265106	205135428	Rat
12879840	Bw179	Body weight QTL 179		0.005	body mass (VT:0001259)	body weight (CMO:0000012)	2	154723085	199723085	Rat
1581502	Esta3	Estrogen-induced thymic atrophy QTL 3			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	2	139067258	192287892	Rat
1358899	Kidm23	Kidney mass QTL 23	3.88		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	27148328	159440891	Rat
1358908	Bw49	Body weight QTL 49	3.36		body mass (VT:0001259)	body weight (CMO:0000012)	2	27148557	159440760	Rat
1582257	Gluco21	Glucose level QTL 21	3.1	0.0035	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	120039407	159440891	Rat
1358910	Kidm27	Kidney mass QTL 27	5.77		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	27148328	159440891	Rat
1358911	Kidm28	Kidney mass QTL 28	5.42		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	27148328	159440891	Rat
1358904	Cm39	Cardiac mass QTL 39	2.26		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	27148328	159440891	Rat
2301966	Bp322	Blood pressure QTL 322	3.58		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	144882354	205135428	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	67845182	205135428	Rat
1358887	Bw50	Body weight QTL 50	2.39		body mass (VT:0001259)	body weight (CMO:0000012)	2	27148557	159440760	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	83400752	223709938	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	44537979	205135428	Rat
1641891	Alcrsp17	Alcohol response QTL 17			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	151869660	251712708	Rat
1359022	Ppulsi1	Prepulse inhibition QTL 1	3.63		prepulse inhibition trait (VT:0003088)	acoustic startle response measurement (CMO:0001519)	2	139067258	184067258	Rat
1358894	Kidm24	Kidney mass QTL 24	4.03		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	27148328	159440891	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	80396034	220931416	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	78269809	205135428	Rat
2301415	Cm67	Cardiac mass QTL 67		0.003	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	2	154723085	178247591	Rat
1331794	Bp202	Blood pressure QTL 202	3.66819		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	143344967	251712708	Rat
71113	Cari2	Carrageenan-induced inflammation QTL 2	2.7	0.009	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	2	143746578	205135428	Rat
1331805	Cm29	Cardiac mass QTL 29	3.50746		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	2	143344967	251712708	Rat
11565180	Kidm56	Kidney mass QTL 56		0.003	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	154723085	178247591	Rat
1598805	Memor8	Memory QTL 8	3		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	2	150096616	195096616	Rat
634308	Sach6	Saccharin preference QTL 6	4.9		taste sensitivity trait (VT:0001986)	saccharin intake volume to total fluid intake volume ratio (CMO:0001601)	2	114384617	215381366	Rat
11565181	Bw176	Body weight QTL 176		0.002	body mass (VT:0001259)	body weight (CMO:0000012)	2	154723085	178247591	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	27148328	206613235	Rat
724568	Uae13	Urinary albumin excretion QTL 13	4.4		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	2	145306936	212705578	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	27148328	206613235	Rat
1300165	Rf9	Renal function QTL 9	3.28		kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	2	113746222	205135428	Rat
61401	Niddm2	Non-insulin dependent diabetes mellitus QTL 2	4.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	147287892	192287892	Rat
631507	Bp105	Blood pressure QTL 105		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	114384617	215381366	Rat
738007	Anxrr7	Anxiety related response QTL 7	4.4		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	2	120339555	165339555	Rat
1641925	Alcrsp2	Alcohol response QTL 2			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	151869660	223841096	Rat
1354609	Niddm62	Non-insulin dependent diabetes mellitus QTL 62	4.72	0.000006	insulin secretion trait (VT:0003564)	plasma insulin level (CMO:0000342)	2	117415288	205135428	Rat
2293835	Kiddil5	Kidney dilation QTL 5	3.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	44537979	159440891	Rat
631520	Bp73	Blood pressure QTL 73		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	149806826	170653323	Rat
1598833	Bp295	Blood pressure QTL 295	3.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	150096616	195096616	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	83465462	225110681	Rat
1558653	Prcr1	Prostate cancer resistance QTL 1	5		prostate integrity trait (VT:0010571)	area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)	2	114440891	159440891	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	47856345	205135428	Rat
2293843	Kiddil6	Kidney dilation QTL 6	3.1		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	44537979	184731399	Rat
1354594	Despr10	Despair related QTL 10		2e-06	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	2	116804572	161804572	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	76328396	209350714	Rat
6903312	Bw112	Body weight QTL 112	3.2	0.0013	body mass (VT:0001259)	body weight (CMO:0000012)	2	145807215	173074435	Rat
152025206	Hrtrt23	Heart rate QTL 23	5.98		heart pumping trait (VT:2000009)		2	30219200	171802126	Rat
152025204	Hrtrt22	Heart rate QTL 22	5.6		heart pumping trait (VT:2000009)		2	30219200	171802126	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
3	6	14	18	17	1	17	1	41	31	6	6	10	16

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031817	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000002	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000053627

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8 Ensembl	2	155,555,327 - 155,555,421 (+)	Ensembl
mRatBN7.2 Ensembl	2	153,245,349 - 153,245,443 (+)	Ensembl
Rnor_6.0 Ensembl	2	165,606,072 - 165,606,166 (+)	Ensembl

RefSeq Acc Id:

NR_031817

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	2	155,555,327 - 155,555,421 (+)	NCBI
mRatBN7.2	2	153,245,349 - 153,245,443 (+)	NCBI
Dahl_SR_JrHsd	2	154,667,417 - 154,667,511 (+)	NCBI
Lyon_Normotensive	2	154,986,395 - 154,986,489 (+)	NCBI
Lyon_Hypertensive	2	154,614,618 - 154,614,712 (+)	NCBI
F344_StmMcwi	2	154,708,200 - 154,708,294 (+)	NCBI
Rnor_6.0	2	165,606,072 - 165,606,166 (+)	NCBI
Celera	2	147,596,149 - 147,596,243 (+)	NCBI

Sequence:

show sequence

CATACTTGTTCCGCTCTAGCAGCACGTAAATATTGGCGTAGTGAAATAAATATTAAACACCAAT
ATTATTGTGCTGCTTTAGTGTGACAGGGATA

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:7488974	AgrOrtholog
BioCyc Gene	G2FUF-52837	BioCyc
Ensembl Genes	ENSRNOG00000035504	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053627	ENTREZGENE
miRBase	MI0000844	ENTREZGENE
NCBI Gene	Mir16	ENTREZGENE
PhenoGen	Mir16-2	PhenoGen
RatGTEx	ENSRNOG00000035504	RatGTEx
RNAcentral	URS00003EDFF6	RNACentral
	URS00004BCD9C	RNACentral
	URS000075CC32	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2025-01-31	Mir16-2	microRNA 16-2	Mir16	microRNA 16	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2015-04-09	Mir16	microRNA 16	Mir16	microRNA mir-16	Name updated	61478	APPROVED
2013-12-10	Mir16	microRNA mir-16			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message