D20Arb8 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D20Arb8

Symbol: D20Arb8
Also known as: D20Arb548; oxsts7802; 
RGD ID: 61316
Expected Size: 186 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map20 RGD
Is Marker For: Strains:   F344.DA-(D20Arb2-D20Arb8)/Arb   DA.F344-(D20Arb2-D20Arb8)/Arb  
QTLs:   Ciaa1   Aia1  
Genes:   Ciaa1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCCAAGTTTATAACTCCAGC
Reverse Primer CAATACAGCCTCTCTTCATA
 

Region

Nucleotide Sequences
GenBank Nucleotide U06689 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326474 UniSTS
  474368 UniSTS
NCBI Nucleotide U06689
UniSTS 239899 UniSTS