Oaz1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Oaz1

Symbol: Oaz1
Previously known as:
RGD ID: 5088026
Expected Size: 157 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21137,084,727 - 37,084,884 (+)MAPPERmRatBN7.2
mRatBN7.278,884,009 - 8,884,166 (+)MAPPERmRatBN7.2
Rnor_6.0711,752,282 - 11,752,438NCBIRnor6.0
Rnor_6.01138,214,257 - 38,214,413NCBIRnor6.0
Rnor_5.01141,724,306 - 41,724,462UniSTSRnor5.0
Rnor_5.0711,919,997 - 11,920,153UniSTSRnor5.0
RGSC_v3.41137,729,562 - 37,729,718UniSTSRGSC3.4
RGSC_v3.4710,394,649 - 10,394,805UniSTSRGSC3.4
Celera77,068,132 - 7,068,288UniSTS
Celera1136,969,348 - 36,969,504UniSTS
Cytogenetic Map7q11UniSTS
Cytogenetic Map11q12UniSTS
Is Marker For: Genes:   Oaz1   Oaz1-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGAGAGGACCCGGGTGAG
Reverse Primer CTTGAGTGTGACAAACACAGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3219Oaz1ornithine decarboxylase antizyme 1788838558886315Rat
3220Oaz1-ps1ornithine decarboxylase antizyme 1, pseudogene 1113708458637085595Rat

Nucleotide Sequences
RefSeq Transcripts NM_139081 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide D10706 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D11372 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D11373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211375 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213504 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213794 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214019 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214458 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ216817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218486 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220491 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220580 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225116 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225909 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ230452 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231088 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ233723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
10755497Bp388Blood pressure QTL 3882.76arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)111945620576331918Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112295940367959403Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113123913478851519Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
70180BpQTLcluster10Blood pressure QTL cluster 103.19arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)113491804179918041Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)111647204744285911Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)112952841860324829Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)112328045668280456Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)112328045668280456Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 25042 UniSTS
  25502 UniSTS