RH139818 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: RH139818

Symbol:

RH139818

Previously known as:

AI010620;

RGD ID:

5077546

Expected Size:

194 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	218,777,868 - 218,778,062 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	238,854,592 - 238,854,785	NCBI	Rnor6.0
Rnor_5.0	1	246,143,164 - 246,143,357	UniSTS	Rnor5.0
RGSC_v3.4	1	224,450,452 - 224,450,645	UniSTS	RGSC3.4
Celera	1	216,033,055 - 216,033,248	UniSTS

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CTCTCTAGGCCCTCAGGATCAA
Reverse Primer	TCTGGAGAGGGTTGGTTAGCAT

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1310776	Zfand5	zinc finger AN1-type containing 5	1	218765735	218780391	Rat


GenBank Nucleotide	CH473953	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000231	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
8693637	Alc29	Alcohol consumption QTL 29	2.7	0.258	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	234238494	Rat
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1357335	Bw39	Body weight QTL 39	3.3		body mass (VT:0001259)	body weight (CMO:0000012)	1	197814409	242814409	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
2302375	Bw83	Body weight QTL 83	4.87	0.0002	body mass (VT:0001259)	body weight (CMO:0000012)	1	197697768	242697768	Rat
1354652	Kidm20	Kidney mass QTL 20	4.3		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	177227632	256448636	Rat
2293674	Bss39	Bone structure and strength QTL 39	7.1	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	1	201554356	246554356	Rat
5508828	Leukc3	Leukocyte quantity QTL 3			eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	1	218108584	224054420	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
61455	Niddm7	Non-insulin dependent diabetes mellitus QTL 7	5.5		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	214537555	238757011	Rat
61327	Eae7	Experimental allergic encephalomyelitis QTL 7	5.6		body mass (VT:0001259)	change in body weight (CMO:0002045)	1	216255568	260522016	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
70163	Bw20	Body weight QTL 20	5.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	174133260	219133260	Rat
1578763	Kidm29	Kidney mass QTL 29	3.3	0.0001	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	1	179567751	260522016	Rat
1600395	Niddm69	Non-insulin dependent diabetes mellitus QTL 69	4.14	0.0002	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	195804352	257091168	Rat
1354624	Cm35	Cardiac mass QTL35	5.7		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	177227632	256448636	Rat
1600396	Niddm68	Non-insulin dependent diabetes mellitus QTL 68	4.97	0.0003	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
1558658	Bw59	Body weight QTL 59	3.5	0.0003	body mass (VT:0001259)	body weight (CMO:0000012)	1	178784622	223784622	Rat
1600397	Edcs4	Endometrial carcinoma susceptibility QTL 4	2.2		uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	1	206081677	251081677	Rat
631838	Niddm36	Non-insulin dependent diabetes mellitus QTL 36		0.01	insulin secretion trait (VT:0003564)	calculated pancreatic islet insulin release measurement (CMO:0001217)	1	184550676	229550676	Rat
8693661	Alc34	Alcohol consumption QTL 34	2.2	0.611	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	228627600	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1600388	Niddm67	Non-insulin dependent diabetes mellitus QTL 67	5.84	0.000004	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
2293694	Bss38	Bone structure and strength QTL 38	7.05	0.0001	femur strength trait (VT:0010010)	femur stiffness (CMO:0001674)	1	201554356	246554356	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
1300145	Rf7	Renal function QTL 7	2.96		urine creatinine amount (VT:0010540)	urine creatinine level (CMO:0000125)	1	185145134	221264292	Rat
8655655	Arrd2	Age-related retinal degeneration QTL 2	7.79		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	183970203	243914901	Rat
1358898	Bp255	Blood pressure QTL 255	3.6		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	191019702	246062233	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
2300175	Bmd40	Bone mineral density QTL 40	15.4	0.0001	femur mineral mass (VT:0010011)	bone mineral density (CMO:0001226)	1	201554356	246554356	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
724538	Kidm1	Kidney mass QTL 1	3.2		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	213707201	252085212	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
737977	Bp160	Blood pressure QTL 160		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	181133855	226133855	Rat
2293655	Bss36	Bone structure and strength QTL 36	10.66	0.0001	femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	201554356	246554356	Rat
1298084	Thym4	Thymus enlargement QTL 4	10.68		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	197814409	242814409	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
8552891	Epfw5	Epididymal fat weight QTL 5	4.4		epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	1	193113876	238113876	Rat
734768	Niddm59	Non-insulin dependent diabetes mellitus QTL 59			body mass (VT:0001259)	body weight (CMO:0000012)	1	213843987	258843987	Rat
1358890	Bp259	Blood pressure QTL 259	3.06		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	210702053	260522016	Rat
724533	Rf51	Renal function QTL 51	5.3	0.0002	kidney plasma flow trait (VT:0005524)	renal plasma flow (CMO:0001914)	1	218753816	256448513	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
1358292	Cm37	Cardiac mass QTL 37	6.2	8e-07	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	1	196248093	241248093	Rat
61376	Bp42	Blood pressure QTL 42	23.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	197814409	242814409	Rat
634313	Niddm43	Non-insulin dependent diabetes mellitus QTL 43			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	199050459	259647894	Rat
634312	Bp143	Blood pressure QTL 143	3	0.0002	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	182623426	219932796	Rat
1549910	Bw54	Body weight QTL 54		0.05	body mass (VT:0001259)	body weight (CMO:0000012)	1	214647894	259647894	Rat
70211	Niddm24	Non-insulin dependent diabetes mellitus QTL 24	3.79		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	214647894	259647894	Rat
1357399	Bw45	Body weight QTL 45	3.05		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	1	206329708	251329708	Rat
1357404	Bw42	Body weight QTL 42	4.49	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	1	206329708	251329708	Rat
10059600	Bp378	Blood pressure QTL 378	3.08	0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	176869060	221869060	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
1358916	Kidm22	Kidney mass QTL 22	3.32		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	210702053	240947965	Rat
2312564	Glom18	Glomerulus QTL 18	2.4	0.003	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	1	185356336	231689108	Rat
634321	Hc1	Hypercalciuria QTL 1	2.91		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	178810256	240830002	Rat
2292218	Kidm35	Kidney mass QTL 35			kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	199368955	224569684	Rat
61400	Niddm1	Non-insulin dependent diabetes mellitus QTL 1	11		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	218753689	245907899	Rat
1331790	Bp201	Blood pressure QTL 201	3.127		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	198211513	225126682	Rat
10059587	Bw173	Body weight QTL 173	3.23	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	1	202069611	247069611	Rat
2292216	Bw80	Body weight QTL 80	3.23	0.0019	body mass (VT:0001259)	body weight (CMO:0000012)	1	213533809	243914901	Rat
61403	Niddm4	Non-insulin dependent diabetes mellitus QTL 4			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	206329708	222745518	Rat
1300168	Bp170	Blood pressure QTL 170	2.76		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	207702246	228581766	Rat
2292220	Bp306	Blood pressure QTL 306	3.47	0.00087	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	243914901	Rat
10059590	Kidm44	Kidney mass QTL 44	3.42	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	191033875	236033875	Rat
1641926	Teswt2	Testicular weight QTL 2	2.82		testis mass (VT:1000644)	both testes wet weight (CMO:0000175)	1	197697768	238755659	Rat
631658	Cm7	Cardiac mass QTL 7	5.32	0.0001	aorta mass (VT:0002845)	aorta weight (CMO:0000076)	1	196248093	241248093	Rat
1600380	Niddm70	Non-insulin dependent diabetes mellitus QTL 70	3.1	0.0008	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	176550523	221550523	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1582206	Kidm33	Kidney mass QTL 33	6.9		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	188377360	224054420	Rat
8655855	Arrd3	Age-related retinal degeneration QTL 3	3.07		lens clarity trait (VT:0001304)	cataract incidence/prevalence measurement (CMO:0001585)	1	183970203	243914901	Rat
634340	Hcar5	Hepatocarcinoma resistance QTL 5	8		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	214537555	226660468	Rat
1600374	Mcs17	Mammary carcinoma susceptibility QTL 17	3		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	1	197670404	242670404	Rat
1600363	Hc6	Hypercalciuria QTL 6	2.7		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	203995416	244113296	Rat
8693618	Alc25	Alcohol consumption QTL 25	3	0.28	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	228627600	Rat
2293083	Iddm25	Insulin dependent diabetes mellitus QTL 25	4.18		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	181829673	224569684	Rat
738032	Hcas5	Hepatocarcinoma susceptibility QTL 5	3.12		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	176426412	257976495	Rat
1358191	Ept10	Estrogen-induced pituitary tumorigenesis QTL 10	3.8		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	192825253	243914732	Rat
2302040	Pia35	Pristane induced arthritis QTL 35	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	216255568	260522016	Rat
7394701	Uae46	Urinary albumin excretion QTL 46	3.6	0.0056	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	201554356	246554356	Rat
1598821	Rf55	Renal function QTL 55	6.3		renal blood flow trait (VT:2000006)	ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)	1	218748008	257976495	Rat

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: RH139818