AU046532 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AU046532

Symbol: AU046532
Previously known as:
RGD ID: 5069388
Expected Size: 179 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21489,037,623 - 89,037,797 (+)MAPPERmRatBN7.2
Rnor_6.01497,615,199 - 97,615,372NCBIRnor6.0
Rnor_5.01497,414,237 - 97,414,410UniSTSRnor5.0
RGSC_v3.41495,399,621 - 95,399,794UniSTSRGSC3.4
Celera1488,159,119 - 88,159,292UniSTS
Is Marker For: Genes:   Glo1-ps2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCTCTCTTGGCTGTCTCCT
Reverse Primer TTCTGTTGCCCACACAGAGAAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2323894Glo1-ps2glyoxalase 1, pseudogene 2148903118089037851Rat

Nucleotide Sequences
GenBank Nucleotide AU046532 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
631213Bw60Body weight QTL604.51retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)147995092195876975Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
4889951Bss92Bone structure and strength QTL 923.9tibia area (VT:1000281)tibia-fibula cortical bone total cross-sectional area (CMO:0001721)148205747195876975Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100362885 UniSTS