BF410086 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: BF410086

Symbol:

BF410086

Previously known as:

RGD ID:

5062948

Expected Size:

215 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	143,505,177 - 143,505,392 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	149,464,305 - 149,464,519	NCBI	Rnor6.0
Rnor_5.0	2	168,896,738 - 168,896,952	UniSTS	Rnor5.0
RGSC_v3.4	2	148,633,795 - 148,634,009	UniSTS	RGSC3.4
Celera	2	137,929,663 - 137,929,877	UniSTS
RH 3.4 Map	2	880.9	UniSTS

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CTCGTGTGCAATTGTCTCCATT
Reverse Primer	TCATCCAAACCTTTGTGAGCAG

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1592212	Med12l	mediator complex subunit 12L	2	143253048	143576507	Rat
621681	P2ry12	purinergic receptor P2Y12	2	143481468	143523340	Rat


GenBank Nucleotide	JH613575.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1578648	Bss11	Bone structure and strength QTL 11	4.7		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	2	114837527	211674221	Rat
2293671	Bss44	Bone structure and strength QTL 44	10.97	0.0001	lumbar vertebra morphology trait (VT:0010494)	lumbar vertebra cortical cross-sectional area (CMO:0001690)	2	43162366	148478373	Rat
631566	Bp90	Blood pressure QTL 90		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	102803808	147803808	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
6907363	Bp357	Blood pressure QTL 357	4.1	0.002	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	129540907	174540907	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
1358360	Sradr2	Stress Responsive Adrenal Weight QTL 2	10.24		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	2	129164097	152195315	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	81754530	227146641	Rat
10755499	Bp389	Blood pressure QTL 389	2.61		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	18960362	228801039	Rat
1298076	Bp166	Blood pressure QTL 166		0.0009	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	136445150	202447032	Rat
152025245	Scl81	Serum cholesterol level QTL 81	3.49		blood cholesterol amount (VT:0000180)		2	122609194	206936711	Rat
1581578	Cm49	Cardiac mass QTL 49	4.9	0.01	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	127447387	143657569	Rat
1549828	Bp258	Blood pressure QTL 258		0.03	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	142323368	150650069	Rat
631198	Cm22	Cardiac mass QTL 22	4.3	0.0008	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	76539322	150540526	Rat
1554319	Bmd2	Bone mineral density QTL 2	13.4	0.0001	lumbar vertebra area (VT:0010570)	lumbar vertebra cross-sectional area (CMO:0001689)	2	114837675	212549332	Rat
1302794	Stl27	Serum triglyceride level QTL 27	4.4	0.0001	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	2	25413423	143657569	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	78665619	219826953	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
70175	BpQTLCluster3	Blood pressure QTL cluster 3	4.128		arterial blood pressure trait (VT:2000000)	absolute change in systolic blood pressure (CMO:0000607)	2	135552573	202446871	Rat
12879844	Kidm62	Kidney mass QTL 62		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	142323368	146786035	Rat
1358901	Cm38	Cardiac mass QTL 38	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1359030	Bp277	Blood pressure QTL 277			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	114837527	185876470	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
12879841	Cm87	Cardiac mass QTL 87		0.026	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	2	142323368	146786035	Rat
1581502	Esta3	Estrogen-induced thymic atrophy QTL 3			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	2	136916935	189599348	Rat
12879842	Cm88	Cardiac mass QTL 88		0.042	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	142323368	146786035	Rat
1358899	Kidm23	Kidney mass QTL 23	3.88		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
12879843	Am3	Aortic mass QTL 3		0.016	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	2	142323368	146786035	Rat
1358908	Bw49	Body weight QTL 49	3.36		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1582257	Gluco21	Glucose level QTL 21	3.1	0.0035	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	118111229	157142209	Rat
1358910	Kidm27	Kidney mass QTL 27	5.77		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358911	Kidm28	Kidney mass QTL 28	5.42		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358904	Cm39	Cardiac mass QTL 39	2.26		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1359035	Bp276	Blood pressure QTL 276			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	114837527	143657569	Rat
8662836	Vetf8	Vascular elastic tissue fragility QTL 8	0.66		thoracic aorta molecular composition trait (VT:0010568)	aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)	2	104559726	149559726	Rat
1358887	Bw50	Body weight QTL 50	2.39		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	81689826	221035911	Rat
5135226	Leukc2	Leukocyte quantity QTL 2			eosinophil quantity (VT:0002602)	blood eosinophil count (CMO:0000033)	2	118111229	149559726	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
2299162	Iddm32	Insulin dependent diabetes mellitus QTL 32	2.36		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	78665616	143657569	Rat
1358894	Kidm24	Kidney mass QTL 24	4.03		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1359022	Ppulsi1	Prepulse inhibition QTL 1	3.63		prepulse inhibition trait (VT:0003088)	acoustic startle response measurement (CMO:0001519)	2	136916935	213594495	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	76539322	202447032	Rat
1331794	Bp202	Blood pressure QTL 202	3.66819		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	141194931	223265385	Rat
71113	Cari2	Carrageenan-induced inflammation QTL 2	2.7	0.009	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	2	141596551	202447032	Rat
1331805	Cm29	Cardiac mass QTL 29	3.50746		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	2	141194931	223265385	Rat
634308	Sach6	Saccharin preference QTL 6	4.9		taste sensitivity trait (VT:0001986)	saccharin intake volume to total fluid intake volume ratio (CMO:0001601)	2	112456140	212696837	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
724568	Uae13	Urinary albumin excretion QTL 13	4.4		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	2	143157029	210020885	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1300165	Rf9	Renal function QTL 9	3.28		kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	2	133914684	202447032	Rat
7488933	Bp368	Blood pressure QTL 368		0.004	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	142323368	147803808	Rat
631507	Bp105	Blood pressure QTL 105		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	112456140	212696837	Rat
738007	Anxrr7	Anxiety related response QTL 7	4.4		exploratory behavior trait (VT:0010471)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	2	118189491	163189491	Rat
9685068	Swd7	Spike wave discharge measurement QTL 7	3.2	0.01	brain electrophysiology trait (VT:0010557)	brain spike-and-wave discharge rate (CMO:0001739)	2	141656606	147588984	Rat
2293835	Kiddil5	Kidney dilation QTL 5	3.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	157142209	Rat
1581552	Pur12	Proteinuria QTL 12	5.19	0.0009	urine total protein amount (VT:0000032)	urine protein excretion rate (CMO:0000759)	2	112103657	148076632	Rat
1558653	Prcr1	Prostate cancer resistance QTL 1	5		prostate integrity trait (VT:0010571)	area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)	2	72532993	157142209	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	81754530	222436696	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
2293843	Kiddil6	Kidney dilation QTL 6	3.1		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	182042367	Rat
1354594	Despr10	Despair related QTL 10		2e-06	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	2	114654253	159654253	Rat
152025206	Hrtrt23	Heart rate QTL 23	5.98		heart pumping trait (VT:2000009)		2	28484589	169504100	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	74786664	206665859	Rat
152025204	Hrtrt22	Heart rate QTL 22	5.6		heart pumping trait (VT:2000009)		2	28484589	169504100	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: BF410086