BE095785 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE095785

Symbol: BE095785
Previously known as:
RGD ID: 5057628
Expected Size: 205 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2725,601,818 - 25,602,023 (+)MAPPERmRatBN7.2
Rnor_6.0731,806,471 - 31,806,675NCBIRnor6.0
Celera722,728,551 - 22,728,755UniSTS
RH 3.4 Map7154.1UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTCTGTGCTGACAATTGAGCCT
Reverse Primer CCACAAGCTTTCCTTGGATTTC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473960 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354644Spl4Serum phospholipid level QTL 44.9blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)71965431749753746Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72192119566921195Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)72409960669099606Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
1354637Scl30Serum cholesterol level QTL 303.7blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)71965431749753746Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
1354639Spl5Serum phospholipid level QTL 53.9blood LDL phospholipid amount (VT:0010505)blood low density lipoprotein phospholipid level (CMO:0001568)71965431752888450Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71794435762944357Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
2290372Gluco33Glucose level QTL 332.71blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)72055570529891047Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
1582260Bw72Body weight QTL 723.20.0043body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582261Bw69Body weight QTL 693.20.0048body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582262Bw75Body weight QTL 7530.0038body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
61369Mcs2Mammary carcinoma susceptibility QTL 23.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)71903280735526300Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
70207Niddm31Non-insulin dependent diabetes mellitus QTL 313.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)71816950526029351Rat


Additional Information