RH142401 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH142401

Symbol: RH142401
Previously known as: AI013694; 
RGD ID: 5053009
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2337,624,395 - 37,624,595 (+)MAPPERmRatBN7.2
Rnor_6.0338,677,287 - 38,677,486NCBIRnor6.0
Rnor_5.0343,774,453 - 43,774,652UniSTSRnor5.0
RGSC_v3.4334,656,602 - 34,656,801UniSTSRGSC3.4
Celera335,763,271 - 35,763,470UniSTS
RH 3.4 Map3455.4UniSTS
Cytogenetic Map3q12UniSTS
Is Marker For: Genes:   Fmnl2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGGAAATAGGCAGTTTGCTTTA
Reverse Primer TAAACTGCCACTTGCTGTCACAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560248Fmnl2formin-like 233734879137624746Rat

Nucleotide Sequences
RefSeq Transcripts XM_001066238.4 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_575134.4 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32793691972936919Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33370334778196190Rat
1298073Cm13Cardiac mass QTL 132.5heart mass (VT:0007028)heart wet weight (CMO:0000069)32501391138192233Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32846857173468571Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32846857173468571Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32749462144188411Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33068464275684642Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32749462150302886Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33370334761017857Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)32749462150302886Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31831145447233430Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31831145447233430Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31831145447233430Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32824968773249687Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33068464275684642Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31831145447233430Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)31077870450302886Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31831145447233430Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32749462150302886Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31831145447233430Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31831145447233430Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32824968773249687Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32824968773249687Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31695470861954708Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32824968773249687Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33142640370668733Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33142640370668733Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33142640370668733Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33142640370668733Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33142640370668733Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33142640370668733Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499797 UniSTS