D14Got32 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Got32

Symbol: D14Got32
Previously known as: oxsts1041; OT12.24; 
RGD ID: 45167
Expected Size: 192 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81424,793,552 - 24,793,744 (+)Marker Load Pipeline
mRatBN7.21424,438,855 - 24,439,049 (+)MAPPERmRatBN7.2
Rnor_6.01426,373,415 - 26,373,606NCBIRnor6.0
Rnor_5.01426,202,320 - 26,202,511UniSTSRnor5.0
RGSC_v3.41426,324,164 - 26,324,356RGDRGSC3.4
RGSC_v3.41426,324,165 - 26,324,356UniSTSRGSC3.4
RGSC_v3.11426,324,164 - 26,324,356RGD
Celera1423,843,718 - 23,843,909UniSTS
RH 2.0 Map14317.2RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGGCCAACACAGAGTGAGAC
Reverse Primer CTCTACCAGTGGTTCCCAAGC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028624 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141103081230320092Rat
2302277Gluco38Glucose level QTL 385.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062228035204Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141759376142336881Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)141863134542337007Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14381307424531477Rat
7387267Uae42Urinary albumin excretion QTL 420.61urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)142216796767167967Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141762256142337007Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141487516830883947Rat


Additional Information