D6Got61 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D6Got61

Symbol: D6Got61
Previously known as: oxsts528; OT04.11; 
RGD ID: 44080
Expected Size: 83 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8655,047,436 - 55,047,519 (+)Marker Load Pipeline
mRatBN7.2649,319,993 - 49,320,076 (+)MAPPERmRatBN7.2
Rnor_6.0652,010,912 - 52,010,994NCBIRnor6.0
Rnor_5.0661,650,241 - 61,650,323UniSTSRnor5.0
RGSC_v3.4651,022,472 - 51,022,555RGDRGSC3.4
RGSC_v3.4651,022,473 - 51,022,555UniSTSRGSC3.4
RGSC_v3.1651,025,599 - 51,025,681RGD
Celera648,513,166 - 48,513,248UniSTS
RH 3.4 Map6301.2RGD
RH 3.4 Map6301.2UniSTS
RH 2.0 Map6517.2RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GGTTTAGGGGTTTGATTGATG
Reverse Primer GATCCTATTGCTGCTTACTAT
 
GenBank Nucleotide AU029211 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 25 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
8693632Alc27Alcohol consumption QTL 272.20.791drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)63432335751121479Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat

1 to 10 of 25 rows