Symbol:
Lnpep
Name:
leucyl and cystinyl aminopeptidase
RGD ID:
621752
Description:
Enables aminopeptidase activity. Involved in several processes, including neuropeptide catabolic process; positive regulation of blood pressure; and regulation of long-term neuronal synaptic plasticity. Located in several cellular components, including insulin-responsive compartment; neuronal cell body; and perinuclear region of cytoplasm. Used to study type 2 diabetes mellitus. Orthologous to human LNPEP (leucyl and cystinyl aminopeptidase); PARTICIPATES IN angiotensin IV signaling pathway; insulin responsive facilitative sugar transporter mediated glucose transport pathway; long term potentiation; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2-naphthylamine; 3,3',4,4',5-pentachlorobiphenyl.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
aminopeptidase Vp165; angiotensin IV receptor; cystinyl aminopeptidase; GP160; insulin-regulated membrane aminopeptidase IRAP; insulin-responsive aminopeptidase; IRAP; leucyl-cystinyl aminopeptidase; leucyl-cystinyl aminopeptidase-like; leucyl/cystinyl aminopeptidase; LOC100912445; LOC108348118; OTase; oxytocinase; P-LAP; placental leucine aminopeptidase; vesicle protein of 165 kDa; Vp165
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 66,931,712 - 67,027,610 (-) NCBI GRCr8 mRatBN7.2 1 58,258,642 - 58,355,532 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 58,258,642 - 58,354,544 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 63,102,623 - 63,198,136 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 71,789,691 - 71,885,226 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 65,012,661 - 65,108,180 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 59,289,392 - 59,384,540 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 59,297,294 - 59,347,472 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 68,436,593 - 68,488,427 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 69,224,555 - 69,275,898 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 56,063,361 - 56,151,257 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 56,074,764 - 56,154,202 (-) NCBI Celera 1 54,460,876 - 54,549,335 (-) NCBI Celera Cytogenetic Map 1 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Lnpep Rat (-)-epigallocatechin 3-gallate multiple interactions ISO LNPEP (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of LNPEP mRNA CTD PMID:22079256 Lnpep Rat (1->4)-beta-D-glucan multiple interactions ISO Lnpep (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of LNPEP mRNA CTD PMID:36331819 Lnpep Rat 1,2-dimethylhydrazine decreases expression ISO Lnpep (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of LNPEP mRNA CTD PMID:22206623 Lnpep Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO LNPEP (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 Lnpep Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of LNPEP mRNA CTD PMID:22298810 Lnpep Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of LNPEP mRNA CTD PMID:33387578 Lnpep Rat 2,6-dimethoxyphenol multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Lnpep Rat 2-naphthylamine increases metabolic processing ISO LNPEP (Homo sapiens) 6480464 LNPEP protein results in increased metabolism of 2-Naphthylamine analog CTD PMID:11732752 Lnpep Rat 2-naphthylamine increases metabolic processing EXP 6480464 LNPEP protein results in increased metabolism of 2-Naphthylamine analog CTD PMID:11732752 Lnpep Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression EXP 6480464 3 more ... CTD PMID:23196670 Lnpep Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Lnpep (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of LNPEP mRNA CTD PMID:26251327 Lnpep Rat 4,4'-sulfonyldiphenol decreases expression ISO Lnpep (Mus musculus) 6480464 bisphenol S results in decreased expression of LNPEP mRNA CTD PMID:39298647 Lnpep Rat 4,4'-sulfonyldiphenol increases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol S results in increased expression of LNPEP protein CTD PMID:34186270 Lnpep Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of LNPEP mRNA CTD PMID:30047161 Lnpep Rat acrolein multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of LNPEP mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of LNPEP mRNA CTD PMID:32699268 Lnpep Rat aflatoxin B1 increases expression ISO LNPEP (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of LNPEP mRNA CTD PMID:21641981 Lnpep Rat aflatoxin B1 decreases methylation ISO LNPEP (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of LNPEP gene CTD PMID:27153756 Lnpep Rat aflatoxin B1 affects expression ISO LNPEP (Homo sapiens) 6480464 Aflatoxin B1 affects the expression of LNPEP protein CTD PMID:20106945 Lnpep Rat all-trans-retinoic acid increases expression ISO LNPEP (Homo sapiens) 6480464 Tretinoin results in increased expression of LNPEP mRNA CTD PMID:33167477 Lnpep Rat alpha-pinene multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of LNPEP mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of LNPEP mRNA CTD PMID:32699268 Lnpep Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of LNPEP mRNA CTD PMID:30047161 and PMID:38685447 Lnpep Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of LNPEP mRNA CTD PMID:16483693 Lnpep Rat amphetamine decreases expression EXP 6480464 Amphetamine results in decreased expression of LNPEP mRNA CTD PMID:30779732 Lnpep Rat aristolochic acid A decreases expression ISO LNPEP (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of LNPEP mRNA CTD PMID:33212167 Lnpep Rat arsane affects methylation ISO LNPEP (Homo sapiens) 6480464 Arsenic affects the methylation of LNPEP gene CTD PMID:25304211 Lnpep Rat arsane multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat arsenic atom affects methylation ISO LNPEP (Homo sapiens) 6480464 Arsenic affects the methylation of LNPEP gene CTD PMID:25304211 Lnpep Rat arsenic atom multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat arsenous acid decreases expression ISO Lnpep (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of LNPEP mRNA CTD PMID:35676786 Lnpep Rat benzo[a]pyrene multiple interactions ISO Lnpep (Mus musculus) 6480464 AHR protein affects the reaction [Benzo(a)pyrene affects the expression of LNPEP mRNA] CTD PMID:22228805 Lnpep Rat benzo[a]pyrene increases methylation ISO LNPEP (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of LNPEP 5' UTR CTD PMID:27901495 Lnpep Rat benzo[a]pyrene increases expression ISO Lnpep (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of LNPEP mRNA CTD PMID:22228805 Lnpep Rat benzo[a]pyrene increases expression ISO LNPEP (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of LNPEP mRNA CTD PMID:21632981 Lnpep Rat benzo[a]pyrene diol epoxide I decreases expression ISO LNPEP (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Lnpep Rat beta-naphthoflavone decreases expression ISO LNPEP (Homo sapiens) 6480464 beta-Naphthoflavone results in decreased expression of LNPEP mRNA CTD PMID:32858204 Lnpep Rat bis(2-ethylhexyl) phthalate multiple interactions EXP 6480464 Diethylhexyl Phthalate affects the reaction [INS1 protein affects the expression of LNPEP protein] CTD PMID:28526321 Lnpep Rat bis(2-ethylhexyl) phthalate increases expression ISO Lnpep (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of LNPEP mRNA CTD PMID:34319233 Lnpep Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of LNPEP mRNA CTD PMID:25181051 and PMID:34947998 Lnpep Rat bisphenol A increases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol A results in increased expression of LNPEP protein CTD PMID:34186270 Lnpep Rat bisphenol A decreases methylation ISO LNPEP (Homo sapiens) 6480464 bisphenol A results in decreased methylation of LNPEP gene CTD PMID:31601247 Lnpep Rat bisphenol A decreases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol A results in decreased expression of LNPEP protein CTD PMID:31675489 Lnpep Rat bisphenol A increases expression ISO Lnpep (Mus musculus) 6480464 bisphenol A results in increased expression of LNPEP mRNA CTD PMID:25594700 Lnpep Rat bisphenol AF increases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol AF results in increased expression of LNPEP protein CTD PMID:34186270 Lnpep Rat Bisphenol B increases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol B results in increased expression of LNPEP protein CTD PMID:34186270 Lnpep Rat bisphenol F increases expression ISO Lnpep (Mus musculus) 6480464 bisphenol F results in increased expression of LNPEP mRNA CTD PMID:38685157 Lnpep Rat bisphenol F increases expression ISO LNPEP (Homo sapiens) 6480464 bisphenol F results in increased expression of LNPEP protein CTD PMID:34186270 Lnpep Rat butanal decreases expression ISO LNPEP (Homo sapiens) 6480464 butyraldehyde results in decreased expression of LNPEP mRNA CTD PMID:26079696 Lnpep Rat C60 fullerene decreases expression EXP 6480464 fullerene C60 results in decreased expression of LNPEP mRNA CTD PMID:19167457 Lnpep Rat cadmium dichloride increases expression ISO Lnpep (Mus musculus) 6480464 Cadmium Chloride results in increased expression of LNPEP mRNA CTD PMID:20883709 Lnpep Rat caffeine decreases phosphorylation ISO LNPEP (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of LNPEP protein CTD PMID:35688186 Lnpep Rat carbon nanotube increases expression ISO Lnpep (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Lnpep Rat CGP 52608 multiple interactions ISO LNPEP (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to LNPEP gene] CTD PMID:28238834 Lnpep Rat chlorpyrifos increases expression ISO Lnpep (Mus musculus) 6480464 Chlorpyrifos results in increased expression of LNPEP mRNA CTD PMID:37019170 Lnpep Rat chromium(6+) decreases expression ISO LNPEP (Homo sapiens) 6480464 chromium hexavalent ion results in decreased expression of LNPEP mRNA CTD PMID:30690063 Lnpep Rat crotonaldehyde decreases expression ISO LNPEP (Homo sapiens) 6480464 2-butenal results in decreased expression of LNPEP mRNA CTD PMID:20471460 Lnpep Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of LNPEP mRNA CTD PMID:26577399 Lnpep Rat cyclosporin A increases expression ISO LNPEP (Homo sapiens) 6480464 Cyclosporine results in increased expression of LNPEP mRNA CTD PMID:20106945 and PMID:25562108 Lnpep Rat DDT decreases expression EXP 6480464 DDT results in decreased expression of LNPEP mRNA CTD PMID:30207508 Lnpep Rat diarsenic trioxide decreases expression ISO Lnpep (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of LNPEP mRNA CTD PMID:35676786 Lnpep Rat Dibutyl phosphate affects expression ISO LNPEP (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of LNPEP mRNA CTD PMID:37042841 Lnpep Rat dibutyl phthalate increases expression ISO Lnpep (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of LNPEP mRNA CTD PMID:21266533 Lnpep Rat dorsomorphin multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Lnpep Rat ethanol increases expression ISO Lnpep (Mus musculus) 6480464 Ethanol results in increased expression of LNPEP mRNA CTD PMID:30319688 Lnpep Rat ethyl methanesulfonate increases expression ISO LNPEP (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of LNPEP mRNA CTD PMID:23649840 Lnpep Rat fenthion decreases expression ISO Lnpep (Mus musculus) 6480464 Fenthion results in decreased expression of LNPEP mRNA CTD PMID:34813904 Lnpep Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of LNPEP mRNA CTD PMID:30307764 Lnpep Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of LNPEP mRNA CTD PMID:24793618 Lnpep Rat folic acid decreases expression ISO LNPEP (Homo sapiens) 6480464 Folic Acid results in decreased expression of LNPEP mRNA CTD PMID:21867686 Lnpep Rat formaldehyde increases expression ISO LNPEP (Homo sapiens) 6480464 Formaldehyde results in increased expression of LNPEP mRNA CTD PMID:23649840 Lnpep Rat FR900359 decreases phosphorylation ISO LNPEP (Homo sapiens) 6480464 FR900359 results in decreased phosphorylation of LNPEP protein CTD PMID:37730182 Lnpep Rat furfural multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Lnpep Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of LNPEP mRNA CTD PMID:33387578 Lnpep Rat ivermectin decreases expression ISO LNPEP (Homo sapiens) 6480464 Ivermectin results in decreased expression of LNPEP protein CTD PMID:32959892 Lnpep Rat manganese atom multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat manganese(0) multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat manganese(II) chloride multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of LNPEP mRNA CTD PMID:30047161 Lnpep Rat methyl methanesulfonate increases expression ISO LNPEP (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of LNPEP mRNA CTD PMID:23649840 Lnpep Rat methylmercury chloride decreases expression ISO LNPEP (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of LNPEP mRNA CTD PMID:28001369 Lnpep Rat mono(2-ethylhexyl) phthalate multiple interactions EXP 6480464 mono-(2-ethylhexyl)phthalate affects the reaction [INS1 protein affects the expression of LNPEP protein] CTD PMID:28526321 Lnpep Rat N-methyl-4-phenylpyridinium decreases expression ISO LNPEP (Homo sapiens) 6480464 1-Methyl-4-phenylpyridinium results in decreased expression of LNPEP mRNA CTD PMID:24810058 Lnpep Rat ozone multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of LNPEP mRNA more ... CTD PMID:32699268 Lnpep Rat paracetamol affects expression ISO Lnpep (Mus musculus) 6480464 Acetaminophen affects the expression of LNPEP mRNA CTD PMID:17562736 Lnpep Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Lnpep (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of LNPEP mRNA CTD PMID:36331819 Lnpep Rat phenobarbital affects expression ISO Lnpep (Mus musculus) 6480464 Phenobarbital affects the expression of LNPEP mRNA CTD PMID:23091169 Lnpep Rat phenylmercury acetate multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of LNPEP mRNA CTD PMID:27188386 Lnpep Rat potassium chromate multiple interactions ISO LNPEP (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of LNPEP mRNA CTD PMID:22079256 Lnpep Rat potassium chromate decreases expression ISO LNPEP (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of LNPEP mRNA CTD PMID:22079256 and PMID:22714537 Lnpep Rat quercetin decreases expression ISO LNPEP (Homo sapiens) 6480464 Quercetin results in decreased expression of LNPEP mRNA CTD PMID:21632981 Lnpep Rat SB 431542 multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Lnpep Rat scopolamine multiple interactions ISO LNPEP (Homo sapiens) 6480464 [AGT protein modified form binds to and results in decreased activity of LNPEP protein] which results in decreased susceptibility to Scopolamine CTD PMID:11707427 Lnpep Rat sodium arsenate increases expression ISO Lnpep (Mus musculus) 6480464 sodium arsenate results in increased expression of LNPEP mRNA CTD PMID:21795629 Lnpep Rat sodium arsenite increases expression ISO Lnpep (Mus musculus) 6480464 sodium arsenite results in increased expression of LNPEP mRNA CTD PMID:20883709 Lnpep Rat sodium arsenite multiple interactions ISO LNPEP (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of LNPEP mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of LNPEP mRNA CTD PMID:39836092 Lnpep Rat sodium arsenite decreases expression ISO LNPEP (Homo sapiens) 6480464 sodium arsenite results in decreased expression of LNPEP mRNA CTD PMID:38568856 Lnpep Rat sodium chloride multiple interactions ISO LNPEP (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of LNPEP protein more ... CTD PMID:38598786 Lnpep Rat succimer multiple interactions ISO Lnpep (Mus musculus) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of LNPEP mRNA CTD PMID:26378955 Lnpep Rat temozolomide increases expression ISO LNPEP (Homo sapiens) 6480464 Temozolomide results in increased expression of LNPEP mRNA CTD PMID:31758290 Lnpep Rat testosterone increases expression ISO Lnpep (Mus musculus) 6480464 Testosterone results in increased expression of LNPEP mRNA CTD PMID:22539767 Lnpep Rat thimerosal multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with Thimerosal co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of LNPEP mRNA CTD PMID:27188386 Lnpep Rat titanium dioxide decreases methylation ISO Lnpep (Mus musculus) 6480464 titanium dioxide results in decreased methylation of LNPEP gene and titanium dioxide results in decreased methylation of LNPEP promoter CTD PMID:35295148 Lnpep Rat trichostatin A increases expression ISO LNPEP (Homo sapiens) 6480464 trichostatin A results in increased expression of LNPEP mRNA CTD PMID:24935251 and PMID:26272509 Lnpep Rat trichostatin A multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of LNPEP mRNA CTD PMID:27188386 Lnpep Rat triclosan decreases expression ISO LNPEP (Homo sapiens) 6480464 Triclosan results in decreased expression of LNPEP mRNA CTD PMID:30510588 Lnpep Rat triphenyl phosphate affects expression ISO LNPEP (Homo sapiens) 6480464 triphenyl phosphate affects the expression of LNPEP mRNA CTD PMID:37042841 Lnpep Rat troglitazone decreases expression ISO Lnpep (Mus musculus) 6480464 troglitazone results in decreased expression of LNPEP mRNA CTD PMID:28973697 Lnpep Rat valproic acid increases expression ISO LNPEP (Homo sapiens) 6480464 Valproic Acid results in increased expression of LNPEP mRNA CTD PMID:23179753 more ... Lnpep Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of LNPEP mRNA CTD PMID:29427782 Lnpep Rat valproic acid multiple interactions ISO LNPEP (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of LNPEP mRNA CTD PMID:27188386 Lnpep Rat vincristine increases expression ISO LNPEP (Homo sapiens) 6480464 Vincristine results in increased expression of LNPEP mRNA CTD PMID:23649840 Lnpep Rat vorinostat decreases expression ISO LNPEP (Homo sapiens) 6480464 vorinostat results in decreased expression of LNPEP mRNA CTD PMID:27188386 Lnpep Rat zoledronic acid increases expression ISO LNPEP (Homo sapiens) 6480464 zoledronic acid results in increased expression of LNPEP mRNA CTD PMID:20977926
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(-)-epigallocatechin 3-gallate (ISO) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,6-dimethoxyphenol (ISO) 2-naphthylamine (EXP,ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) acrolein (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-pinene (ISO) amitrole (EXP) ammonium chloride (EXP) amphetamine (EXP) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-naphthoflavone (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) butanal (ISO) C60 fullerene (EXP) cadmium dichloride (ISO) caffeine (ISO) carbon nanotube (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) chromium(6+) (ISO) crotonaldehyde (ISO) Cuprizon (EXP) cyclosporin A (ISO) DDT (EXP) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dorsomorphin (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fenthion (ISO) fenvalerate (EXP) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) furfural (ISO) gentamycin (EXP) ivermectin (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methimazole (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) mono(2-ethylhexyl) phthalate (EXP) N-methyl-4-phenylpyridinium (ISO) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) potassium chromate (ISO) quercetin (ISO) SB 431542 (ISO) scopolamine (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sodium chloride (ISO) succimer (ISO) temozolomide (ISO) testosterone (ISO) thimerosal (ISO) titanium dioxide (ISO) trichostatin A (ISO) triclosan (ISO) triphenyl phosphate (ISO) troglitazone (ISO) valproic acid (EXP,ISO) vincristine (ISO) vorinostat (ISO) zoledronic acid (ISO)
1.
AT4 receptor is insulin-regulated membrane aminopeptidase: potential mechanisms of memory enhancement.
Albiston AL, etal., Trends Endocrinol Metab. 2003 Mar;14(2):72-7.
2.
Identification and characterization of two distinct intracellular GLUT4 pools in rat skeletal muscle: evidence for an endosomal and an insulin-sensitive GLUT4 compartment.
Aledo JC, etal., Biochem J. 1997 Aug 1;325 ( Pt 3):727-32.
3.
Distribution and cellular localization of insulin-regulated aminopeptidase in the rat central nervous system.
Fernando RN, etal., J Comp Neurol. 2005 Jul 11;487(4):372-90.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
A role for the angiotensin IV/AT4 system in mediating natriuresis in the rat.
Hamilton TA, etal., Peptides. 2001 Jun;22(6):935-44.
7.
Early primary diagnosis of ovarian cancer and detection of recurrence by serum cystine aminopeptidase assay.
Kalinkov D and Buchholz R, Am J Obstet Gynecol. 1980 Dec 15;138(8):1148-50.
8.
Acyl-coenzyme A dehydrogenases are localized on GLUT4-containing vesicles via association with insulin-regulated aminopeptidase in a manner dependent on its dileucine motif.
Katagiri H, etal., Mol Endocrinol 2002 May;16(5):1049-59.
9.
Cloning and characterization of a novel insulin-regulated membrane aminopeptidase from Glut4 vesicles.
Keller SR, etal., J Biol Chem 1995 Oct 6;270(40):23612-8.
10.
The effects of angiotensin IV analogs on long-term potentiation within the CA1 region of the hippocampus in vitro.
Kramar EA, etal., Brain Res. 2001 Apr 6;897(1-2):114-21.
11.
The GLUT4 code.
Larance M, etal., Mol Endocrinol. 2008 Feb;22(2):226-33. Epub 2007 Aug 23.
12.
Cystinyl aminopeptidase activity is decreased in renal cell carcinomas.
Larrinaga G, etal., Regul Pept. 2007 Dec 4;144(1-3):56-61. Epub 2007 Jun 21.
13.
Insulin-regulated aminopeptidase marks an antigen-stimulated recycling compartment in mast cells.
Liao H, etal., Traffic. 2006 Feb;7(2):155-67.
14.
Role of insulin-dependent cortical fodrin/spectrin remodeling in glucose transporter 4 translocation in rat adipocytes.
Liu L, etal., Mol Biol Cell. 2006 Oct;17(10):4249-56. Epub 2006 Jul 26.
15.
Adipocytes exhibit abnormal subcellular distribution and translocation of vesicles containing glucose transporter 4 and insulin-regulated aminopeptidase in type 2 diabetes mellitus: implications regarding defects in vesicle trafficking.
Maianu L, etal., J Clin Endocrinol Metab. 2001 Nov;86(11):5450-6.
16.
Vp165 and GLUT4 share similar vesicle pools along their trafficking pathways in rat adipose cells.
Malide D, etal., FEBS Lett. 1997 Jun 16;409(3):461-8.
17.
Aminopeptidase activities in breast cancer tissue.
Martinez JM, etal., Clin Chem. 1999 Oct;45(10):1797-802.
18.
Involvement of the V2 receptor in vasopressin-stimulated translocation of placental leucine aminopeptidase/oxytocinase in renal cells.
Masuda S, etal., Eur J Biochem 2003 May;270(9):1988-94.
19.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
20.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
21.
IRAP deficiency attenuates diet-induced obesity in mice through increased energy expenditure.
Niwa M, etal., Biochem Biophys Res Commun. 2015 Jan 30;457(1):12-8. doi: 10.1016/j.bbrc.2014.12.071. Epub 2014 Dec 19.
22.
Novel Roles for the Insulin-Regulated Glucose Transporter-4 in Hippocampally Dependent Memory.
Pearson-Leary J and McNay EC, J Neurosci. 2016 Nov 23;36(47):11851-11864. doi: 10.1523/JNEUROSCI.1700-16.2016.
23.
Insulin-regulated aminopeptidase/placental leucil Aminopeptidase (IRAP/P-lAP) and angiotensin IV-forming activities are modified in serum of rats with breast cancer induced by N-methyl-nitrosourea.
Pilar Carrera M, etal., Anticancer Res. 2006 Mar-Apr;26(2A):1011-4.
24.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
25.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
26.
The renin-angiotensin system: peptides and enzymes beyond angiotensin II.
Reudelhuber TL Curr Opin Nephrol Hypertens. 2005 Mar;14(2):155-9.
27.
GOA pipeline
RGD automated data pipeline
28.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
29.
Protein kinase C-zeta phosphorylates insulin-responsive aminopeptidase in vitro at Ser-80 and Ser-91.
Ryu J, etal., Arch Biochem Biophys 2002 Jul 1;403(1):71-82.
30.
[Feto-placental system in diabetes mellitus and hydramnios]
Savchenko ON, etal., Akush Ginekol (Mosk). 1991 Dec;(12):12-5.
31.
Placental leucine aminopeptidase (P-LAP) expression is associated with chemosensitivity in human endometrial carcinoma.
Shibata K, etal., Gynecol Oncol. 2004 Nov;95(2):307-13.
32.
Placental leucine aminopeptidase (P-LAP) and glucose transporter 4 (GLUT4) expression in benign, borderline, and malignant ovarian epithelia.
Shibata K, etal., Gynecol Oncol. 2005 Jul;98(1):11-8.
33.
Expression of placental leucine aminopeptidase is associated with a poor outcome in endometrial endometrioid adenocarcinoma.
Shibata K, etal., Oncology. 2004;66(4):288-95.
34.
Involvement of the somatostatin-2 receptor in the anti-convulsant effect of angiotensin IV against pilocarpine-induced limbic seizures in rats.
Stragier B, etal., J Neurochem. 2006 Aug;98(4):1100-13. Epub 2006 Jun 12.
35.
Impaired insulin-regulated membrane aminopeptidase translocation to the plasma membrane in adipocytes of Otsuka Long Evans Tokushima Fatty rats.
Takeuchi M, etal., Nagoya J Med Sci. 2006 Jun;68(3-4):155-63.
36.
A Glut4-vesicle marker protein, insulin-responsive aminopeptidase, is localized in a novel vesicular compartment in PC12 cells.
Thoidis G and Kandror KV, Traffic. 2001 Aug;2(8):577-87.
37.
Increased decidual mRNA expression levels of candidate maternal pre-eclampsia susceptibility genes are associated with clinical severity.
Yong HE, etal., Placenta. 2014 Feb;35(2):117-24. doi: 10.1016/j.placenta.2013.11.008. Epub 2013 Nov 25.
Lnpep Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 66,931,712 - 67,027,610 (-) NCBI GRCr8 mRatBN7.2 1 58,258,642 - 58,355,532 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 58,258,642 - 58,354,544 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 63,102,623 - 63,198,136 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 71,789,691 - 71,885,226 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 65,012,661 - 65,108,180 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 59,289,392 - 59,384,540 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 59,297,294 - 59,347,472 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 68,436,593 - 68,488,427 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 69,224,555 - 69,275,898 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 56,063,361 - 56,151,257 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 56,074,764 - 56,154,202 (-) NCBI Celera 1 54,460,876 - 54,549,335 (-) NCBI Celera Cytogenetic Map 1 q12 NCBI
LNPEP Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 96,936,080 - 97,037,513 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 96,935,394 - 97,037,513 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 96,271,784 - 96,373,217 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 96,297,102 - 96,390,871 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 96,297,554 - 96,390,496 NCBI Celera 5 92,155,866 - 92,249,526 (+) NCBI Celera Cytogenetic Map 5 q15 NCBI HuRef 5 91,461,444 - 91,554,831 (+) NCBI HuRef CHM1_1 5 95,704,043 - 95,797,761 (+) NCBI CHM1_1 T2T-CHM13v2.0 5 97,435,206 - 97,538,276 (+) NCBI T2T-CHM13v2.0
Lnpep Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 17,747,985 - 17,846,303 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 17,741,672 - 17,845,312 (-) Ensembl GRCm39 Ensembl GRCm38 17 17,527,723 - 17,624,489 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 17,521,410 - 17,625,050 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 17,664,687 - 17,761,453 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 17,232,341 - 17,329,107 (-) NCBI MGSCv36 mm8 Celera 17 18,469,713 - 18,559,683 (-) NCBI Celera Cytogenetic Map 17 A3.2 NCBI cM Map 17 9.77 NCBI
Lnpep Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955418 15,640,143 - 15,718,711 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955418 15,631,703 - 15,718,711 (-) NCBI ChiLan1.0 ChiLan1.0
LNPEP Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 92,184,252 - 92,287,343 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 5 90,338,199 - 90,476,858 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 5 92,247,060 - 92,348,900 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 5 97,800,922 - 97,902,830 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 5 97,842,110 - 97,893,876 (+) Ensembl panpan1.1 panPan2
LNPEP Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 3 12,668,994 - 12,766,712 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 3 12,681,577 - 12,767,183 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 3 14,009,029 - 14,107,850 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 3 12,551,891 - 12,650,977 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 3 12,564,239 - 12,650,899 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 3 12,513,108 - 12,612,033 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 3 12,508,231 - 12,607,129 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 3 12,708,005 - 12,806,860 (-) NCBI UU_Cfam_GSD_1.0
Lnpep Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 168,257,072 - 168,346,916 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936523 6,445,939 - 6,532,566 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936523 6,443,571 - 6,533,122 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
LNPEP Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 103,567,602 - 103,661,070 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 103,568,366 - 103,659,589 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 107,369,918 - 107,462,862 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap 2 p17-p14 NCBI
LNPEP Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 4 90,769,988 - 90,872,205 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 4 90,770,272 - 90,863,268 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666049 39,417,543 - 39,519,028 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Lnpep
.
Predicted Target Of
Count of predictions: 147 Count of miRNA genes: 113 Interacting mature miRNAs: 125 Transcripts: ENSRNOT00000017718 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1331732 Srn4 Serum renin concentration QTL 4 4.467 renin activity (VT:0005581) plasma renin activity level (CMO:0000116) 1 35239598 78430678 Rat 2313059 Bss55 Bone structure and strength QTL 55 3.2 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1578649 Bmd8 Bone mineral density QTL 8 4.9 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 1 49393172 94393172 Rat 1358359 Sradr1 Stress Responsive Adrenal Weight QTL 1 4.74 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 30882023 123479925 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 4889929 Bss87 Bone structure and strength QTL 87 6.7 tibia area (VT:1000281) tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722) 1 53895117 82174945 Rat 1331792 Rf29 Renal function QTL 29 4.589 urine potassium amount (VT:0010539) urine potassium level (CMO:0000128) 1 35239598 78430678 Rat 2313062 Bmd73 Bone mineral density QTL 73 3.9 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 11481312 82174945 Rat 8552900 Pigfal1 Plasma insulin-like growth factor 1 level QTL 1 7.4 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1554320 Bmd1 Bone mineral density QTL 1 12.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 509108 86060548 Rat 1354643 Foco2 Food consumption QTL 2 7.17 0.0001 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 1 33449848 78449848 Rat 2302059 Pia36 Pristane induced arthritis QTL 36 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 43333002 88333002 Rat 2313065 Bss67 Bone structure and strength QTL 67 3.1 0.0001 tibia area (VT:1000281) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 1357400 Bw62 Body weight QTL62 4.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 1 22340647 67340647 Rat 2313069 Bss68 Bone structure and strength QTL 68 2.9 0.0001 tibia size trait (VT:0100001) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 2313075 Bss66 Bone structure and strength QTL 66 3.4 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 11481312 82174945 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 2313072 Bss53 Bone structure and strength QTL 53 4.3 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 43284731 118944897 Rat 1300167 Hrtrt2 Heart rate QTL 2 4.35 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 11481312 75088344 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 2313078 Bss54 Bone structure and strength QTL 54 3.5 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 2313077 Bss69 Bone structure and strength QTL 69 3.5 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 11481312 82174945 Rat 1331778 Rf28 Renal function QTL 28 4.66 urine potassium amount (VT:0010539) urine potassium excretion rate (CMO:0000761) 1 45803140 78430678 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 1331785 Rf27 Renal function QTL 27 4.643 urine sodium amount (VT:0006274) urine sodium level (CMO:0000129) 1 28879780 78430678 Rat 61342 Bp27 Blood pressure QTL 27 3.4 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 56732668 98773277 Rat 1300172 Bp172 Blood pressure QTL 172 3.56 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 32737273 90665040 Rat 4889962 Bss94 Bone structure and strength QTL 94 3.8 tibia area (VT:1000281) tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722) 1 49361465 82174945 Rat 724520 Bp145 Blood pressure QTL 145 2.1 0.0024 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 20784828 65784828 Rat 2313094 Bss58 Bone structure and strength QTL 58 3.7 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 43284731 118944897 Rat 6903308 Scl36 Serum cholesterol QTL 36 2 0.0125 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 53863041 90532583 Rat 2313092 Bmd72 Bone mineral density QTL 72 2.5 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 11481312 82174945 Rat 2300164 Bmd44 Bone mineral density QTL 44 5.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 1 56949932 101949932 Rat 2313099 Bss56 Bone structure and strength QTL 56 2.4 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 1 43284731 118944897 Rat 2313098 Bmd70 Bone mineral density QTL 70 3.6 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 43284731 118944897 Rat 2313097 Bss70 Bone structure and strength QTL 70 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 9589820 Insglur3 Insulin/glucose ratio QTL 3 10.75 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 1 34836858 79836858 Rat 152025249 Scl82 Serum cholesterol level QTL 82 4.77 blood cholesterol amount (VT:0000180) 1 50343510 99980958 Rat 738020 Pia8 Pristane induced arthritis QTL 8 4.7 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 1 65833076 Rat 1354599 Bw29 Body weight QTL 29 3.46 0.001 body mass (VT:0001259) body weight (CMO:0000012) 1 33449848 78449848 Rat 4889919 Bss86 Bone structure and strength QTL 86 4.1 tibia area (VT:1000281) tibia midshaft total cross-sectional area (CMO:0001715) 1 53895117 82174945 Rat 8552948 Pigfal11 Plasma insulin-like growth factor 1 level QTL 11 4.7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 2313051 Bss57 Bone structure and strength QTL 57 3.7 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 43284731 118944897 Rat
BF398876
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 1 66,995,432 - 66,995,657 (+) Marker Load Pipeline mRatBN7.2 1 58,322,365 - 58,322,590 (+) MAPPER mRatBN7.2 Rnor_6.0 1 59,352,191 - 59,352,415 NCBI Rnor6.0 Rnor_5.0 1 60,278,510 - 60,278,734 UniSTS Rnor5.0 RGSC_v3.4 1 56,119,023 - 56,119,247 UniSTS RGSC3.4 Celera 1 54,516,537 - 54,516,761 UniSTS RH 3.4 Map 1 657.0 UniSTS Cytogenetic Map 1 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
10
13
48
121
95
94
54
36
54
6
234
112
96
48
65
40
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017718 ⟹ ENSRNOP00000017718
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 58,258,642 - 58,354,544 (-) Ensembl Rnor_6.0 Ensembl 1 59,297,294 - 59,347,472 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000080325 ⟹ ENSRNOP00000069259
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 58,258,642 - 58,318,387 (-) Ensembl Rnor_6.0 Ensembl 1 68,436,593 - 68,488,229 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000088586 ⟹ ENSRNOP00000070725
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 58,258,642 - 58,318,486 (-) Ensembl Rnor_6.0 Ensembl 1 68,436,917 - 68,488,427 (+) Ensembl
RefSeq Acc Id:
NM_001113403 ⟹ NP_001106874
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 66,931,712 - 67,027,610 (-) NCBI mRatBN7.2 1 58,258,642 - 58,354,544 (-) NCBI Rnor_6.0 1 59,297,451 - 59,384,344 (-) NCBI Rnor_5.0 1 69,224,555 - 69,275,898 (+) NCBI RGSC_v3.4 1 56,063,361 - 56,151,257 (-) RGD Celera 1 54,460,876 - 54,549,335 (-) RGD
Sequence:
TCGGGGCCGCTTCAGCTCTCGGAGTAGAAAGCTTGGGGCGCTGGGCTGGTGAGGACCCGCAGCGGGCGAAGATGGAGACCTTTACCAATGATCGACTTCAGCTTCCAAGGAATATGATTGAAAACAGC
hide sequence
RefSeq Acc Id:
NP_001106874 ⟸ NM_001113403
- UniProtKB:
Q11009 (UniProtKB/Swiss-Prot), P97629 (UniProtKB/Swiss-Prot), A6KB65 (UniProtKB/TrEMBL), A0A0G2JUW8 (UniProtKB/TrEMBL)
- Sequence:
METFTNDRLQLPRNMIENSMFEEEPDVVDLAKEPCLHPLEPDEVEYEPRGSRLLVRGLGEHEMDEDEEDYESSAKLLGMSFMNRSSGLRNSATGYRQSPDGTCSVPSARTLVICVFVIVVAVSVIMVI
hide sequence
Ensembl Acc Id:
ENSRNOP00000069259 ⟸ ENSRNOT00000080325
Ensembl Acc Id:
ENSRNOP00000017718 ⟸ ENSRNOT00000017718
Ensembl Acc Id:
ENSRNOP00000070725 ⟸ ENSRNOT00000088586
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Lnpep
leucyl and cystinyl aminopeptidase
LOC108348118
leucyl-cystinyl aminopeptidase
Data merged from RGD:11480606
737654 PROVISIONAL
2020-08-21
Lnpep
leucyl and cystinyl aminopeptidase
LOC100912445
leucyl-cystinyl aminopeptidase-like
Data merged from RGD:6487002
737654 PROVISIONAL
2016-10-26
Lnpep
leucyl and cystinyl aminopeptidase
Lnpep
leucyl/cystinyl aminopeptidase
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2016-08-02
LOC108348118
leucyl-cystinyl aminopeptidase
Symbol and Name status set to provisional
70820 PROVISIONAL
2012-07-05
LOC100912445
leucyl-cystinyl aminopeptidase-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2006-03-30
Lnpep
leucyl/cystinyl aminopeptidase
aminopeptidase Vp165
Name updated
1299863 APPROVED
2004-09-10
Lnpep
aminopeptidase Vp165
Vp165
Symbol and Name updated
1299863 APPROVED
2002-08-07
Vp165
aminopeptidase Vp165
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_cellular_localization
localized to vesicles and upon insulin stimulation is recruited to the plasma membrane
gene_domains
contains two dileucine motifs, a large extracellular catalytic domain and a single transmembrane domain
