Symbol:
Hddc3
Name:
HD domain containing 3
RGD ID:
1311839
Description:
Predicted to enable guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity. Orthologous to human HDDC3 (HD domain containing 3); INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase MESH1; HD domain-containing protein 3; LOC308758; RGD1311839; similar to RIKEN cDNA 1110033O09
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
HDDC3 (HD domain containing 3) HGNC
EggNOG, Ensembl, HomoloGene, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Hddc3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Hddc3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
HDDC3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
HDDC3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Hddc3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
HDDC3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
HDDC3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Hddc3 (HD domain containing 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
PRSS41 (serine protease 41) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
HDDC3 (HD domain containing 3)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Hddc3 (HD domain containing 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
hddc3 (HD domain containing 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
ZK909.3
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Mesh1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
hddc3
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 143,708,703 - 143,711,010 (+) NCBI GRCr8 mRatBN7.2 1 134,299,469 - 134,301,757 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 134,299,468 - 134,301,757 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 142,208,351 - 142,210,636 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 149,377,749 - 149,380,034 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 142,295,585 - 142,297,870 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 142,136,428 - 142,138,737 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 142,136,452 - 142,138,737 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 143,088,853 - 143,091,138 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 136,161,425 - 136,163,710 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 136,239,835 - 136,241,412 (+) NCBI Celera 1 126,359,496 - 126,361,781 (+) NCBI Celera Cytogenetic Map 1 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Hddc3 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of HDDC3 mRNA] CTD PMID:31150632 Hddc3 Rat 1,2-dimethylhydrazine multiple interactions ISO Hddc3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of HDDC3 mRNA CTD PMID:22206623 Hddc3 Rat 17alpha-ethynylestradiol affects expression ISO Hddc3 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of HDDC3 mRNA CTD PMID:17555576 Hddc3 Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of HDDC3 mRNA CTD PMID:17557909 Hddc3 Rat 17beta-estradiol multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in decreased expression of HDDC3 mRNA CTD PMID:30165855 Hddc3 Rat 17beta-estradiol increases expression ISO Hddc3 (Mus musculus) 6480464 Estradiol results in increased expression of HDDC3 mRNA CTD PMID:39298647 Hddc3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of HDDC3 mRNA CTD PMID:21215274 Hddc3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of HDDC3 mRNA CTD PMID:33387578 Hddc3 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of HDDC3 mRNA CTD PMID:21346803 Hddc3 Rat 2-hydroxypropanoic acid decreases expression ISO HDDC3 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of HDDC3 mRNA CTD PMID:30851411 Hddc3 Rat 2-methylcholine affects expression ISO HDDC3 (Homo sapiens) 6480464 beta-methylcholine affects the expression of HDDC3 mRNA CTD PMID:21179406 Hddc3 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of HDDC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of HDDC3 mRNA CTD PMID:28628672 Hddc3 Rat 4,4'-sulfonyldiphenol multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of HDDC3 mRNA CTD PMID:28628672 Hddc3 Rat 4,4'-sulfonyldiphenol increases expression ISO Hddc3 (Mus musculus) 6480464 bisphenol S results in increased expression of HDDC3 mRNA CTD PMID:39298647 Hddc3 Rat 5-aza-2'-deoxycytidine affects expression ISO HDDC3 (Homo sapiens) 6480464 Decitabine affects the expression of HDDC3 mRNA CTD PMID:23300844 Hddc3 Rat acrolein multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of HDDC3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased expression of HDDC3 mRNA CTD PMID:32699268 Hddc3 Rat acrylamide decreases expression ISO HDDC3 (Homo sapiens) 6480464 Acrylamide results in decreased expression of HDDC3 mRNA CTD PMID:32763439 Hddc3 Rat alpha-pinene multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of HDDC3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased expression of HDDC3 mRNA CTD PMID:32699268 Hddc3 Rat aristolochic acid A decreases expression ISO HDDC3 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of HDDC3 mRNA CTD PMID:33212167 Hddc3 Rat arsane multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of HDDC3 mRNA CTD PMID:32525701 Hddc3 Rat arsenic atom multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of HDDC3 mRNA CTD PMID:32525701 Hddc3 Rat benzo[a]pyrene decreases methylation ISO HDDC3 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of HDDC3 promoter CTD PMID:27901495 Hddc3 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of HDDC3 mRNA CTD PMID:25181051 Hddc3 Rat bisphenol A increases expression ISO Hddc3 (Mus musculus) 6480464 bisphenol A results in increased expression of HDDC3 mRNA CTD PMID:32156529 Hddc3 Rat bisphenol A multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of HDDC3 mRNA CTD PMID:28628672 Hddc3 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of HDDC3 gene CTD PMID:28505145 Hddc3 Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of HDDC3 mRNA CTD PMID:33453195 Hddc3 Rat cadmium dichloride affects expression EXP 6480464 Cadmium Chloride affects the expression of HDDC3 mRNA CTD PMID:22110744 Hddc3 Rat carbamazepine affects expression ISO HDDC3 (Homo sapiens) 6480464 Carbamazepine affects the expression of HDDC3 mRNA CTD PMID:25979313 Hddc3 Rat chlorpyrifos decreases expression ISO Hddc3 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of HDDC3 mRNA CTD PMID:37019170 Hddc3 Rat cisplatin affects expression ISO HDDC3 (Homo sapiens) 6480464 Cisplatin affects the expression of HDDC3 mRNA CTD PMID:23300844 Hddc3 Rat cisplatin increases expression ISO HDDC3 (Homo sapiens) 6480464 Cisplatin results in increased expression of HDDC3 mRNA CTD PMID:27392435 Hddc3 Rat cisplatin multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of HDDC3 mRNA CTD PMID:27392435 Hddc3 Rat clofibric acid multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of HDDC3 mRNA CTD PMID:17602206 Hddc3 Rat cobalt dichloride decreases expression ISO HDDC3 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of HDDC3 mRNA CTD PMID:19320972 Hddc3 Rat copper(II) sulfate decreases expression ISO HDDC3 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of HDDC3 mRNA CTD PMID:19549813 Hddc3 Rat cyclosporin A increases expression ISO HDDC3 (Homo sapiens) 6480464 Cyclosporine results in increased expression of HDDC3 mRNA CTD PMID:27989131 Hddc3 Rat dexamethasone multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of HDDC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of HDDC3 mRNA CTD PMID:28628672 Hddc3 Rat diazinon increases methylation ISO HDDC3 (Homo sapiens) 6480464 Diazinon results in increased methylation of HDDC3 gene CTD PMID:22964155 Hddc3 Rat Dibutyl phosphate affects expression ISO HDDC3 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of HDDC3 mRNA CTD PMID:37042841 Hddc3 Rat dibutyl phthalate decreases expression ISO Hddc3 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of HDDC3 mRNA CTD PMID:21266533 Hddc3 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of HDDC3 mRNA CTD PMID:29391264 Hddc3 Rat epoxiconazole increases expression ISO Hddc3 (Mus musculus) 6480464 epoxiconazole results in increased expression of HDDC3 mRNA CTD PMID:35436446 Hddc3 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of HDDC3 mRNA CTD PMID:24136188 Hddc3 Rat folic acid multiple interactions ISO Hddc3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of HDDC3 mRNA CTD PMID:22206623 Hddc3 Rat indometacin multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of HDDC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of HDDC3 mRNA CTD PMID:28628672 Hddc3 Rat ivermectin decreases expression ISO HDDC3 (Homo sapiens) 6480464 Ivermectin results in decreased expression of HDDC3 protein CTD PMID:32959892 Hddc3 Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of HDDC3 mRNA CTD PMID:30467583 Hddc3 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of HDDC3 mRNA CTD PMID:17602206 Hddc3 Rat ozone multiple interactions ISO Hddc3 (Mus musculus) 6480464 [NOTCH3 gene mutant form affects the susceptibility to Ozone] which affects the expression of HDDC3 mRNA CTD PMID:25658374 Hddc3 Rat ozone multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased expression of HDDC3 mRNA more ... CTD PMID:32699268 Hddc3 Rat paracetamol decreases expression ISO HDDC3 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of HDDC3 mRNA CTD PMID:22230336 Hddc3 Rat pirinixic acid increases expression ISO Hddc3 (Mus musculus) 6480464 pirinixic acid results in increased expression of HDDC3 mRNA CTD PMID:18301758 Hddc3 Rat propiconazole decreases expression ISO Hddc3 (Mus musculus) 6480464 propiconazole results in decreased expression of HDDC3 mRNA CTD PMID:21278054 Hddc3 Rat rac-lactic acid decreases expression ISO HDDC3 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of HDDC3 mRNA CTD PMID:30851411 Hddc3 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of HDDC3 mRNA CTD PMID:28374803 Hddc3 Rat sodium arsenate multiple interactions ISO HDDC3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of HDDC3 mRNA CTD PMID:32525701 Hddc3 Rat sodium arsenite decreases expression ISO HDDC3 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of HDDC3 mRNA CTD PMID:25879800 and PMID:38568856 Hddc3 Rat sodium arsenite increases expression ISO Hddc3 (Mus musculus) 6480464 sodium arsenite results in increased expression of HDDC3 mRNA CTD PMID:37682722 Hddc3 Rat tamoxifen affects expression ISO Hddc3 (Mus musculus) 6480464 Tamoxifen affects the expression of HDDC3 mRNA CTD PMID:17555576 Hddc3 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of HDDC3 mRNA CTD PMID:31150632 Hddc3 Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of HDDC3 mRNA] CTD PMID:31150632 Hddc3 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of HDDC3 mRNA CTD PMID:34492290 Hddc3 Rat triazines multiple interactions ISO Hddc3 (Mus musculus) 6480464 Triazines inhibits the reaction [IDH2 protein mutant form results in increased expression of HDDC3 mRNA] CTD PMID:27469509 Hddc3 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of HDDC3 mRNA CTD PMID:33387578 Hddc3 Rat tunicamycin increases expression ISO HDDC3 (Homo sapiens) 6480464 Tunicamycin results in increased expression of HDDC3 mRNA CTD PMID:29453283 Hddc3 Rat urethane decreases expression ISO HDDC3 (Homo sapiens) 6480464 Urethane results in decreased expression of HDDC3 mRNA CTD PMID:28818685 Hddc3 Rat valproic acid affects expression ISO HDDC3 (Homo sapiens) 6480464 Valproic Acid affects the expression of HDDC3 mRNA CTD PMID:25979313
Hddc3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 143,708,703 - 143,711,010 (+) NCBI GRCr8 mRatBN7.2 1 134,299,469 - 134,301,757 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 134,299,468 - 134,301,757 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 142,208,351 - 142,210,636 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 149,377,749 - 149,380,034 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 142,295,585 - 142,297,870 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 142,136,428 - 142,138,737 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 142,136,452 - 142,138,737 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 143,088,853 - 143,091,138 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 136,161,425 - 136,163,710 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 136,239,835 - 136,241,412 (+) NCBI Celera 1 126,359,496 - 126,361,781 (+) NCBI Celera Cytogenetic Map 1 q31 NCBI
HDDC3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 90,929,968 - 90,932,569 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 90,929,968 - 90,935,196 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 91,473,198 - 91,475,799 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 15 89,275,159 - 89,276,778 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 15 67,883,353 - 67,884,972 (-) NCBI Celera Cytogenetic Map 15 q26.1 NCBI HuRef 15 67,585,438 - 67,587,057 (-) NCBI HuRef CHM1_1 15 91,315,753 - 91,317,372 (-) NCBI CHM1_1 T2T-CHM13v2.0 15 88,689,551 - 88,694,729 (-) NCBI T2T-CHM13v2.0
Hddc3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 79,992,864 - 80,000,479 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 79,992,852 - 80,000,295 (+) Ensembl GRCm39 Ensembl GRCm38 7 80,343,075 - 80,346,716 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 80,343,104 - 80,350,547 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 87,488,023 - 87,490,983 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 80,216,650 - 80,219,610 (+) NCBI MGSCv36 mm8 Celera 7 77,744,603 - 77,746,179 (+) NCBI Celera Cytogenetic Map 7 D2 NCBI cM Map 7 45.65 NCBI
Hddc3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955416 14,990,031 - 14,995,818 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955416 14,993,492 - 14,995,818 (-) NCBI ChiLan1.0 ChiLan1.0
HDDC3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 16 80,484,407 - 80,488,605 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 15 84,183,061 - 84,187,259 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 15 69,623,932 - 69,628,130 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 15 88,821,307 - 88,822,950 (-) NCBI panpan1.1 PanPan1.1 panPan2
HDDC3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 3 53,310,364 - 53,312,034 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 3 53,310,404 - 53,311,693 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 3 55,947,991 - 55,949,662 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 3 53,726,384 - 53,728,068 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 3 53,726,427 - 53,727,724 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 3 53,245,629 - 53,247,302 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 3 53,456,747 - 53,458,426 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 3 53,797,243 - 53,798,915 (+) NCBI UU_Cfam_GSD_1.0
Hddc3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 130,242,697 - 130,244,349 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936483 16,090,063 - 16,097,278 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936483 16,090,191 - 16,092,442 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
HDDC3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 53,525,989 - 53,528,004 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 53,525,984 - 53,527,913 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 58,557,178 - 58,559,084 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
HDDC3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 29 8,930,104 - 8,931,824 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 29 8,929,474 - 8,932,063 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 37,794,213 - 37,795,870 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Hddc3
.
Predicted Target Of
Count of predictions: 107 Count of miRNA genes: 86 Interacting mature miRNAs: 95 Transcripts: ENSRNOT00000016445 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61442 Strs1 Sensitivity to stroke QTL 1 7.4 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 1 121767634 166767634 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1598866 Bp287 Blood pressure QTL 287 5.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 1578770 Stresp23 Stress response QTL 23 kidney sympathetic nerve activity (VT:0004050) stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786) 1 123350408 182418476 Rat 9590300 Scort16 Serum corticosterone level QTL 16 4.39 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 103111621 148111621 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 631199 Cm23 Cardiac mass QTL 23 4.6 0.0004 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 115585465 172949803 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 1598850 Bp297 Blood pressure QTL 297 2.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 631570 Bp94 Blood pressure QTL 94 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123479780 142990467 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 152025232 Bw192 Body weight QTL 192 3.93 body mass (VT:0001259) 1 117917486 196963478 Rat 724521 Uae1 Urinary albumin excretion QTL 1 3.8 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 90508614 173018436 Rat 1358902 Bw47 Body weight QTL 47 1.67 body mass (VT:0001259) body weight (CMO:0000012) 1 90508614 180359386 Rat 61346 Rf2 Renal disease susceptibility QTL 2 3.7 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 1 99267916 144267916 Rat 8655649 Arrd1 Age-related retinal degeneration QTL 1 4.89 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 100357752 183970443 Rat 1300153 Bp171 Blood pressure QTL 171 3.37 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 90664883 143200202 Rat 2317833 Alcrsp19 Alcohol response QTL 19 12.4 0.001 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 631202 Gluco13 Glucose level QTL 13 0.0001 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 131763437 159756369 Rat 631205 Bp196 Blood pressure QTL 196 4 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118944897 199050459 Rat 1300158 Bp173 Blood pressure QTL 173 3.48 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 1 115540693 185145286 Rat 1641897 Alcrsp1 Alcohol response QTL 1 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 1331749 Hrtrt11 Heart rate QTL 11 2.973 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 94494440 198211706 Rat 1331751 Bp199 Blood pressure QTL 199 3.60022 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 94494440 181830018 Rat 2293142 Bp314 Blood pressure QTL 314 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 92184926 137184926 Rat 9685799 Bp375 Blood pressure QTL 375 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 2293140 Bp313 Blood pressure QTL 313 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121833674 166833674 Rat 9685802 Bp376 Blood pressure QTL 376 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 126540680 171540680 Rat 724529 Cm16 Cardiac mass QTL 16 2.7 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 1 87580395 150700247 Rat 61370 Mcs3 Mammary carcinoma susceptibility QTL 3 2.15 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 102268556 147268556 Rat 1641895 Bp298 Blood pressure QTL 298 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 123350408 182418476 Rat 70209 Niddm23 Non-insulin dependent diabetes mellitus QTL 23 2.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 94494440 198324465 Rat 631496 Bp97 Blood pressure QTL 97 3.08 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 106047847 151047847 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 2303591 Gluco41 Glucose level QTL 41 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 102168504 147168504 Rat 1331793 Bp200 Blood pressure QTL 200 3.71601 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94494440 172949803 Rat 2313060 Bss71 Bone structure and strength QTL 71 2.6 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 1 118944747 163944747 Rat 6893347 Bw98 Body weight QTL 98 0.2 0.53 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354591 Cm36 Cardiac mass QTL 36 4.1 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 102813953 201278233 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 61399 Tcat1 Tongue tumor resistance QTL 1 3.3 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879) 1 99267916 144267916 Rat 6893361 Bw104 Body weight QTL 104 0.59 0.27 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 724567 Tcas6 Tongue tumor susceptibility QTL 6 6.85 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 1 92948896 144267916 Rat 738006 Anxrr14 Anxiety related response QTL 14 4 0.00035 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1558645 Bw55 Body weight QTL 55 3.2 0.004 body mass (VT:0001259) body weight (CMO:0000012) 1 133680936 178680936 Rat 1354615 Cm32 Cardiac mass QTL 32 5.2 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 102813953 201278233 Rat 634348 Bp138 Blood pressure QTL 138 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 168883176 Rat 8694370 Bw154 Body weight QTL 154 8.91 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 1 103111621 148111621 Rat 738028 Anxrr12 Anxiety related response QTL 12 4.9 0.00001 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1354623 Rf46 Renal function QTL 46 3.8 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 1 102813953 151162766 Rat 631654 Bp107 Blood pressure QTL 107 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 631544 Bp84 Blood pressure QTL 84 5.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350408 181759564 Rat 152025212 Bw190 Body weight QTL 190 5.7 body mass (VT:0001259) 1 123556856 196963478 Rat 631549 Bp89 Blood pressure QTL 89 5.7 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350581 201284552 Rat 1358189 Cstrr1 Cold stress response QTL 1 0.0001 catecholamine amount (VT:0010543) urine norepinephrine level (CMO:0001629) 1 123350408 182418476 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat
RH133835
Rat Assembly Chr Position (strand) Source JBrowse RH 3.4 Map 1 1070.8 UniSTS Cytogenetic Map 1 q31 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000016445 ⟹ ENSRNOP00000016445
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 134,299,472 - 134,301,757 (+) Ensembl Rnor_6.0 Ensembl 1 142,136,452 - 142,138,737 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000099679 ⟹ ENSRNOP00000080516
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 134,299,468 - 134,301,757 (+) Ensembl
RefSeq Acc Id:
NM_001107528 ⟹ NP_001100998
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 143,708,725 - 143,711,010 (+) NCBI mRatBN7.2 1 134,299,472 - 134,301,757 (+) NCBI Rnor_6.0 1 142,136,452 - 142,138,737 (+) NCBI Rnor_5.0 1 143,088,853 - 143,091,138 (+) NCBI RGSC_v3.4 1 136,161,425 - 136,163,710 (+) RGD Celera 1 126,359,496 - 126,361,781 (+) RGD
Sequence:
CCCCCGCGCCACCCGCGCGATGGGATCGGAGGCAGCTCAGCTGCTGGAGGCTGCTGACTTCGCCGCTCAAAAACACCGACAGCAGCGACGGAAAGATCCTGAAGGGACTCCCTACATCAATCACCCCA
hide sequence
RefSeq Acc Id:
XM_006229431 ⟹ XP_006229493
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 143,708,703 - 143,710,311 (+) NCBI mRatBN7.2 1 134,299,469 - 134,301,058 (+) NCBI Rnor_6.0 1 142,136,464 - 142,138,038 (+) NCBI Rnor_5.0 1 143,088,853 - 143,091,138 (+) NCBI
Sequence:
CCGCGCGATGGGATCGGAGGCAGCTCAGCTGCTGGAGGCTGCTGACTTCGCCGCTCAAAAACAC
hide sequence
RefSeq Acc Id:
NP_001100998 ⟸ NM_001107528
- UniProtKB:
D4A500 (UniProtKB/TrEMBL), A6JCA5 (UniProtKB/TrEMBL)
- Sequence:
MGSEAAQLLEAADFAAQKHRQQRRKDPEGTPYINHPIGVARILTHEAGITDIVVLQAALLHDTVEDTDTTLDEVELHFGAQVRRLVEEVTDDKTLPKLERKRQQVEQAPHSSPGAKLVKLADKLHNLR
hide sequence
RefSeq Acc Id:
XP_006229493 ⟸ XM_006229431
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZQC5 (UniProtKB/TrEMBL)
- Sequence:
MPCVARILTHEAGITDIVVLQAALLHDTVEDTDTTLDEVELHFGAQVRRLVEEVTDDKTLPKLE
hide sequence
Ensembl Acc Id:
ENSRNOP00000016445 ⟸ ENSRNOT00000016445
Ensembl Acc Id:
ENSRNOP00000080516 ⟸ ENSRNOT00000099679
RGD ID: 13690145 Promoter ID: EPDNEW_R668 Type: initiation region Name: Hddc3_1 Description: HD domain containing 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 142,136,449 - 142,136,509 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Hddc3
HD domain containing 3
Hddc3_predicted
HD domain containing 3 (predicted)
'predicted' is removed
2292626 APPROVED
2006-03-30
Hddc3_predicted
HD domain containing 3 (predicted)
RGD1311839_predicted
similar to RIKEN cDNA 1110033O09 (predicted)
Symbol and Name updated
1299863 APPROVED
2005-01-20
RGD1311839_predicted
similar to RIKEN cDNA 1110033O09 (predicted)
LOC308758_predicted
Symbol and Name status set to approved
1331353 APPROVED
2005-01-12
LOC308758_predicted
similar to RIKEN cDNA 1110033O09 (predicted)
Symbol and Name status set to provisional
70820 PROVISIONAL
