Symbol:
P4hb
Name:
prolyl 4-hydroxylase subunit beta
RGD ID:
3244
Description:
Enables enzyme binding activity and protein disulfide isomerase activity. Predicted to be involved in several processes, including positive regulation of substrate adhesion-dependent cell spreading; positive regulation of viral entry into host cell; and protein maturation. Predicted to act upstream of with a positive effect on endoplasmic reticulum to Golgi vesicle-mediated transport. Predicted to act upstream of or within cellular response to interleukin-7 and peptidyl-proline hydroxylation to 4-hydroxy-L-proline. Predicted to be located in several cellular components, including cytosol; endoplasmic reticulum-Golgi intermediate compartment; and lamellipodium. Predicted to be part of endoplasmic reticulum chaperone complex and procollagen-proline 4-dioxygenase complex. Predicted to be active in endoplasmic reticulum lumen and external side of plasma membrane. Human ortholog(s) of this gene implicated in Cole-Carpenter syndrome. Orthologous to human P4HB (prolyl 4-hydroxylase subunit beta); PARTICIPATES IN Endoplasmic Reticulum-associated degradation pathway; INTERACTS WITH (S)-nicotine; 1,3-dinitrobenzene; 17alpha-ethynylestradiol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
cellular thyroid hormone-binding protein; PDI; PDIR; prolyl 4-hydroxylase, beta polypeptide; protein disulfide isomerase; protein disulfide isomerase (Prolyl 4-hydroxylase, beta polypeptide); protein disulfide-isomerase
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
P4HB (prolyl 4-hydroxylase subunit beta) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
P4hb (prolyl 4-hydroxylase, beta polypeptide) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
P4hb (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
P4HB (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
P4HB (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
P4hb (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
P4HB (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
P4HB (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
P4hb (prolyl 4-hydroxylase subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
P4hb (prolyl 4-hydroxylase, beta polypeptide)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
P4HB (prolyl 4-hydroxylase subunit beta)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
p4hb (prolyl 4-hydroxylase, beta polypeptide)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
EUG1
Alliance
DIOPT (OMA|OrthoFinder|OrthoInspector)
Caenorhabditis elegans (roundworm):
pdi-2
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
PDI1
Alliance
DIOPT (OMA|OrthoFinder|OrthoInspector)
Caenorhabditis elegans (roundworm):
M04D5.1
Alliance
DIOPT (Ensembl Compara|PANTHER|PhylomeDB)
Drosophila melanogaster (fruit fly):
Pdi
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Pdi
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
pdi-1
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
p4hb
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 106,335,300 - 106,346,911 (-) NCBI GRCr8 mRatBN7.2 10 105,836,972 - 105,848,583 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 105,836,982 - 105,848,500 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 110,941,098 - 110,952,604 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 110,404,126 - 110,415,632 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 105,757,420 - 105,769,031 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 109,736,459 - 109,748,070 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 109,736,458 - 109,747,987 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 109,329,596 - 109,341,091 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 109,950,221 - 109,961,716 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 109,964,724 - 109,976,220 (-) NCBI Celera 10 104,380,384 - 104,391,995 (-) NCBI Celera Cytogenetic Map 10 q32.3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
P4hb Rat (+)-catechin multiple interactions ISO P4HB (Homo sapiens) 6480464 [Catechin co-treated with Grape Seed Proanthocyanidins] results in decreased expression of P4HB mRNA CTD PMID:24763279 P4hb Rat (-)-epigallocatechin 3-gallate increases expression ISO P4HB (Homo sapiens) 6480464 epigallocatechin gallate results in increased expression of P4HB protein CTD PMID:31195006 P4hb Rat (S)-nicotine decreases expression EXP 6480464 Nicotine results in decreased expression of P4HB protein CTD PMID:28681937 P4hb Rat 1,2-dimethylhydrazine multiple interactions ISO P4hb (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of P4HB mRNA CTD PMID:22206623 P4hb Rat 1,3-dinitrobenzene increases metabolic processing EXP 6480464 3-dinitrobenzene results in increased metabolism of P4HB protein CTD PMID:21402099 P4hb Rat 1-chloro-2,4-dinitrobenzene affects binding ISO P4HB (Homo sapiens) 6480464 Dinitrochlorobenzene binds to P4HB protein CTD PMID:32991956 P4hb Rat 17alpha-ethynylestradiol affects expression ISO P4hb (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of P4HB mRNA CTD PMID:17555576 P4hb Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of P4HB mRNA CTD PMID:17108234 P4hb Rat 17alpha-ethynylestradiol increases expression ISO P4hb (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of P4HB mRNA CTD PMID:17942748 P4hb Rat 17alpha-ethynylestradiol multiple interactions ISO P4hb (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of P4HB mRNA CTD PMID:17942748 P4hb Rat 17beta-estradiol multiple interactions EXP 6480464 bisphenol A inhibits the reaction [Estradiol binds to P4HB protein] CTD PMID:16543366 P4hb Rat 17beta-estradiol multiple interactions ISO P4HB (Homo sapiens) 6480464 [Estradiol co-treated with Bucladesine co-treated with Medroxyprogesterone Acetate] results in increased expression of P4HB mRNA CTD PMID:20823114 P4hb Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO P4hb (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of P4HB mRNA CTD PMID:17942748 P4hb Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of P4HB mRNA CTD PMID:34747641 P4hb Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO P4hb (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of P4HB mRNA CTD PMID:21570461 P4hb Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of P4HB mRNA CTD PMID:18796159 and PMID:33387578 P4hb Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:19954255 P4hb Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression EXP 6480464 2 more ... CTD PMID:19954255 P4hb Rat 2,4-dichlorophenol multiple interactions EXP 6480464 2 more ... CTD PMID:16617682 P4hb Rat 2,6-dimethoxyphenol multiple interactions ISO P4HB (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 P4hb Rat 2-methyl-2-[4-(1,2,3,4-tetrahydronaphthalen-1-yl)phenoxy]propanoic acid increases expression EXP 6480464 Nafenopin results in increased expression of P4HB protein CTD PMID:10903494 P4hb Rat 3,3',5'-triiodo-L-thyronine multiple interactions EXP 6480464 2 more ... CTD PMID:16617682 P4hb Rat 3,3',5'-triiodo-L-thyronine affects binding EXP 6480464 Triiodothyronine and Reverse binds to P4HB protein CTD PMID:16617682 P4hb Rat 3,3',5,5'-tetrabromobisphenol A multiple interactions EXP 6480464 tetrabromobisphenol A inhibits the reaction [Triiodothyronine and Reverse binds to P4HB protein] CTD PMID:16617682 P4hb Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO P4HB (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of P4HB protein CTD PMID:30098271 P4hb Rat 3,3',5-triiodo-L-thyronine multiple interactions EXP 6480464 4-OH-2' more ... CTD PMID:17928132 more ... P4hb Rat 3,3',5-triiodo-L-thyronine affects binding EXP 6480464 Triiodothyronine binds to P4HB protein CTD PMID:17928132 more ... P4hb Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of P4HB mRNA CTD PMID:30071829 P4hb Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin analog results in increased expression of P4HB protein CTD PMID:26597043 P4hb Rat 4,4'-diaminodiphenylmethane decreases expression ISO P4hb (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of P4HB mRNA CTD PMID:18648102 P4hb Rat 4,4'-sulfonyldiphenol increases expression ISO P4hb (Mus musculus) 6480464 bisphenol S results in increased expression of P4HB mRNA CTD PMID:39298647 P4hb Rat 4,4'-sulfonyldiphenol increases expression ISO P4HB (Homo sapiens) 6480464 bisphenol S results in increased expression of P4HB protein CTD PMID:34186270 P4hb Rat 4,4'-sulfonyldiphenol decreases methylation ISO P4HB (Homo sapiens) 6480464 bisphenol S results in decreased methylation of P4HB gene CTD PMID:31601247 P4hb Rat 4-hydroxynon-2-enal affects metabolic processing EXP 6480464 4-hydroxy-2-nonenal affects the metabolism of P4HB protein CTD PMID:16097806 P4hb Rat 4-hydroxyphenyl retinamide decreases expression ISO P4hb (Mus musculus) 6480464 Fenretinide results in decreased expression of P4HB mRNA CTD PMID:28973697 P4hb Rat 4-nonylphenol multiple interactions EXP 6480464 4-nonylphenol inhibits the reaction [Triiodothyronine and Reverse binds to P4HB protein] CTD PMID:16617682 P4hb Rat 4-nonylphenol decreases activity EXP 6480464 4-nonylphenol results in decreased activity of P4HB protein CTD PMID:16617682 P4hb Rat 4-octylphenol decreases activity EXP 6480464 4-octylphenol results in decreased activity of P4HB protein CTD PMID:16617682 P4hb Rat 4-octylphenol multiple interactions EXP 6480464 4-octylphenol inhibits the reaction [Triiodothyronine and Reverse binds to P4HB protein] CTD PMID:16617682 P4hb Rat 5-azacytidine increases expression EXP 6480464 Azacitidine results in increased expression of P4HB protein CTD PMID:17105402 P4hb Rat 5-azacytidine increases expression ISO P4HB (Homo sapiens) 6480464 Azacitidine results in increased expression of P4HB mRNA CTD PMID:20823114 P4hb Rat 5-fluorouracil decreases expression ISO P4HB (Homo sapiens) 6480464 Fluorouracil results in decreased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of P4HB mRNA CTD PMID:30047161 P4hb Rat aldehydo-D-glucose increases expression EXP 6480464 Glucose results in increased expression of P4HB protein CTD PMID:34801538 P4hb Rat aldehydo-D-glucose multiple interactions EXP 6480464 Chlorogenic Acid inhibits the reaction [Glucose results in increased expression of P4HB protein] and Metformin inhibits the reaction [Glucose results in increased expression of P4HB protein] CTD PMID:34801538 P4hb Rat all-trans-retinoic acid increases expression ISO P4HB (Homo sapiens) 6480464 Tretinoin results in increased expression of P4HB mRNA CTD PMID:33167477 P4hb Rat allopurinol decreases expression ISO P4HB (Homo sapiens) 6480464 Allopurinol results in decreased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of P4HB mRNA CTD PMID:30047161 P4hb Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of P4HB mRNA CTD PMID:16483693 P4hb Rat aristolochic acid A decreases expression ISO P4HB (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of P4HB mRNA CTD PMID:33212167 P4hb Rat Aroclor 1254 decreases expression ISO P4hb (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of P4HB mRNA CTD PMID:23650126 P4hb Rat arsane increases expression ISO P4HB (Homo sapiens) 6480464 Arsenic results in increased expression of P4HB protein CTD PMID:19818359 P4hb Rat arsenic atom increases expression ISO P4HB (Homo sapiens) 6480464 Arsenic results in increased expression of P4HB protein CTD PMID:19818359 P4hb Rat arsenite(3-) decreases expression ISO P4hb (Mus musculus) 6480464 arsenite results in decreased expression of P4HB mRNA CTD PMID:18929588 P4hb Rat arsenite(3-) multiple interactions ISO P4hb (Mus musculus) 6480464 TRP53 protein affects the reaction [arsenite results in decreased expression of P4HB mRNA] CTD PMID:18929588 P4hb Rat arsenous acid increases expression ISO P4HB (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of P4HB mRNA CTD PMID:20458559 P4hb Rat Azoxymethane multiple interactions ISO P4hb (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of P4HB mRNA CTD PMID:29950665 P4hb Rat benzatropine decreases expression ISO P4HB (Homo sapiens) 6480464 Benztropine results in decreased expression of P4HB protein CTD PMID:34122009 P4hb Rat benzo[a]pyrene decreases expression ISO P4HB (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of P4HB mRNA CTD PMID:20106945 P4hb Rat beta-lapachone decreases expression ISO P4HB (Homo sapiens) 6480464 beta-lapachone results in decreased expression of P4HB mRNA CTD PMID:38218311 P4hb Rat bexarotene increases expression EXP 6480464 bexarotene results in increased expression of P4HB mRNA CTD PMID:16648578 P4hb Rat bis(2-ethylhexyl) phthalate increases expression ISO P4HB (Homo sapiens) 6480464 Diethylhexyl Phthalate results in increased expression of P4HB mRNA CTD PMID:31163220 P4hb Rat bis(2-ethylhexyl) phthalate decreases expression ISO P4HB (Homo sapiens) 6480464 Diethylhexyl Phthalate results in decreased expression of P4HB protein CTD PMID:31163220 P4hb Rat bisphenol A multiple interactions EXP 6480464 bisphenol A binds to and results in decreased activity of P4HB protein more ... CTD PMID:16543366 more ... P4hb Rat bisphenol A increases expression ISO P4HB (Homo sapiens) 6480464 bisphenol A results in increased expression of P4HB protein CTD PMID:37567409 P4hb Rat bisphenol A decreases expression ISO P4HB (Homo sapiens) 6480464 bisphenol A results in decreased expression of P4HB protein CTD PMID:34186270 P4hb Rat bisphenol A decreases expression ISO P4hb (Mus musculus) 6480464 bisphenol A results in decreased expression of P4HB protein CTD PMID:35999755 P4hb Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of P4HB mRNA and bisphenol A results in decreased expression of P4HB protein CTD PMID:32145629 and PMID:34947998 P4hb Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of P4HB mRNA CTD PMID:30903817 P4hb Rat bisphenol A affects expression ISO P4HB (Homo sapiens) 6480464 bisphenol A affects the expression of P4HB mRNA CTD PMID:30903817 P4hb Rat bisphenol A affects binding EXP 6480464 bisphenol A binds to P4HB protein CTD PMID:18515855 P4hb Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of P4HB mRNA and bisphenol A results in increased expression of P4HB protein CTD PMID:20219716 and PMID:25181051 P4hb Rat bisphenol A decreases activity EXP 6480464 bisphenol A results in decreased activity of P4HB protein CTD PMID:16617682 P4hb Rat bisphenol AF increases expression ISO P4HB (Homo sapiens) 6480464 bisphenol AF results in increased expression of P4HB protein CTD PMID:34186270 P4hb Rat Bisphenol B increases expression ISO P4HB (Homo sapiens) 6480464 bisphenol B results in increased expression of P4HB protein CTD PMID:34186270 P4hb Rat bisphenol F increases expression ISO P4HB (Homo sapiens) 6480464 bisphenol F results in increased expression of P4HB protein CTD PMID:34186270 P4hb Rat bleomycin A2 increases expression EXP 6480464 Bleomycin results in increased expression of P4HB protein CTD PMID:25933445 P4hb Rat Brodifacoum increases expression EXP 6480464 bromfenacoum results in increased expression of P4HB protein CTD PMID:28903499 P4hb Rat bromobenzene affects binding EXP 6480464 bromobenzene metabolite binds to P4HB protein CTD PMID:12018992 P4hb Rat bucladesine multiple interactions ISO P4HB (Homo sapiens) 6480464 [Estradiol co-treated with Bucladesine co-treated with Medroxyprogesterone Acetate] results in increased expression of P4HB mRNA CTD PMID:20823114 P4hb Rat cadmium atom multiple interactions ISO P4HB (Homo sapiens) 6480464 [Cadmium Chloride co-treated with Cadmium] results in increased expression of P4HB protein and [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of P4HB protein CTD PMID:33040242 and PMID:34516972 P4hb Rat cadmium dichloride multiple interactions ISO P4HB (Homo sapiens) 6480464 [Cadmium Chloride co-treated with Cadmium] results in increased expression of P4HB protein and [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of P4HB protein CTD PMID:33040242 and PMID:34516972 P4hb Rat cadmium dichloride increases expression ISO P4HB (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of P4HB mRNA CTD PMID:38568856 P4hb Rat cadmium dichloride affects expression ISO P4HB (Homo sapiens) 6480464 Cadmium Chloride affects the expression of P4HB mRNA CTD PMID:23828170 P4hb Rat calcidiol decreases expression EXP 6480464 Calcifediol deficiency results in decreased expression of P4HB mRNA CTD PMID:17293106 P4hb Rat calcitriol multiple interactions EXP 6480464 [Calcium co-treated with Calcitriol] affects the expression of P4HB mRNA CTD PMID:15913539 P4hb Rat calcium atom multiple interactions EXP 6480464 [Calcium co-treated with Calcitriol] affects the expression of P4HB mRNA CTD PMID:15913539 P4hb Rat calcium(0) multiple interactions EXP 6480464 [Calcium co-treated with Calcitriol] affects the expression of P4HB mRNA CTD PMID:15913539 P4hb Rat captan increases expression ISO P4hb (Mus musculus) 6480464 Captan results in increased expression of P4HB mRNA CTD PMID:31558096 P4hb Rat carbon nanotube increases expression ISO P4hb (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 P4hb Rat chlorogenic acid multiple interactions EXP 6480464 Chlorogenic Acid inhibits the reaction [Glucose results in increased expression of P4HB protein] CTD PMID:34801538 P4hb Rat chloropicrin decreases expression ISO P4HB (Homo sapiens) 6480464 chloropicrin results in decreased expression of P4HB mRNA CTD PMID:26352163 and PMID:28476498 P4hb Rat cisplatin decreases expression ISO P4HB (Homo sapiens) 6480464 Cisplatin results in decreased expression of P4HB protein CTD PMID:21924258 P4hb Rat cisplatin increases expression ISO P4hb (Mus musculus) 6480464 Cisplatin results in increased expression of P4HB mRNA CTD PMID:15464296 P4hb Rat clobetasol increases expression ISO P4hb (Mus musculus) 6480464 Clobetasol results in increased expression of P4HB mRNA CTD PMID:27462272 P4hb Rat clofibrate decreases expression EXP 6480464 Clofibrate results in decreased expression of P4HB protein CTD PMID:16470657 P4hb Rat copper atom affects binding ISO P4HB (Homo sapiens) 6480464 P4HB protein binds to Copper CTD PMID:14534351 and PMID:15359738 P4hb Rat copper(0) affects binding ISO P4HB (Homo sapiens) 6480464 P4HB protein binds to Copper CTD PMID:14534351 and PMID:15359738 P4hb Rat copper(II) sulfate decreases expression ISO P4HB (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of P4HB mRNA CTD PMID:19549813 P4hb Rat coumestrol multiple interactions ISO P4HB (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in increased expression of P4HB mRNA CTD PMID:19167446 P4hb Rat CU-O LINKAGE decreases expression ISO P4HB (Homo sapiens) 6480464 cupric oxide results in decreased expression of P4HB protein CTD PMID:25470785 P4hb Rat cyclosporin A increases expression ISO P4hb (Mus musculus) 6480464 Cyclosporine results in increased expression of P4HB mRNA and Cyclosporine results in increased expression of P4HB protein CTD PMID:23308384 more ... P4hb Rat cyclosporin A increases expression ISO P4HB (Homo sapiens) 6480464 Cyclosporine results in increased expression of P4HB mRNA CTD PMID:20106945 and PMID:23830897 P4hb Rat cylindrospermopsin decreases expression ISO P4HB (Homo sapiens) 6480464 cylindrospermopsin results in decreased expression of P4HB protein CTD PMID:27494769 P4hb Rat D-glucose increases expression EXP 6480464 Glucose results in increased expression of P4HB protein CTD PMID:34801538 P4hb Rat D-glucose multiple interactions EXP 6480464 Chlorogenic Acid inhibits the reaction [Glucose results in increased expression of P4HB protein] and Metformin inhibits the reaction [Glucose results in increased expression of P4HB protein] CTD PMID:34801538 P4hb Rat dexamethasone multiple interactions ISO P4hb (Mus musculus) 6480464 [Dexamethasone co-treated with TNFSF11 protein] results in increased expression of P4HB protein and toxoflavin analog inhibits the reaction [[Dexamethasone co-treated with TNFSF11 protein] results in increased expression of P4HB protein] CTD PMID:39393751 P4hb Rat dextran sulfate multiple interactions ISO P4hb (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of P4HB mRNA CTD PMID:29950665 P4hb Rat dextran sulfate decreases expression ISO P4hb (Mus musculus) 6480464 Dextran Sulfate results in decreased expression of P4HB protein CTD PMID:35999755 P4hb Rat diarsenic trioxide increases expression ISO P4HB (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of P4HB mRNA CTD PMID:20458559 P4hb Rat Dibutyl phosphate affects expression ISO P4HB (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of P4HB mRNA CTD PMID:37042841 P4hb Rat diclofenac increases expression EXP 6480464 Diclofenac results in increased expression of P4HB protein CTD PMID:25772430 P4hb Rat diclofenac multiple interactions EXP 6480464 [Diclofenac co-treated with lipopolysaccharide and E coli O55-B5] results in increased expression of P4HB protein CTD PMID:25772430 P4hb Rat doxorubicin affects expression ISO P4HB (Homo sapiens) 6480464 Doxorubicin affects the expression of P4HB protein CTD PMID:29385562 P4hb Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of P4HB mRNA and Endosulfan results in increased expression of P4HB protein CTD PMID:29391264 and PMID:31464424 P4hb Rat Enterolactone multiple interactions ISO P4HB (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in increased expression of P4HB mRNA CTD PMID:19167446 P4hb Rat ethanol affects splicing ISO P4hb (Mus musculus) 6480464 Ethanol affects the splicing of P4HB mRNA CTD PMID:30319688 P4hb Rat ethanol decreases expression ISO P4hb (Mus musculus) 6480464 Ethanol results in decreased expression of P4HB mRNA CTD PMID:34755883 P4hb Rat fenofibrate affects expression EXP 6480464 Fenofibrate affects the expression of P4HB mRNA CTD PMID:20801182 P4hb Rat fenthion decreases expression ISO P4hb (Mus musculus) 6480464 Fenthion results in decreased expression of P4HB mRNA CTD PMID:34813904 P4hb Rat fluoxetine increases expression EXP 6480464 Fluoxetine results in increased expression of P4HB mRNA CTD PMID:21852994 P4hb Rat folic acid multiple interactions ISO P4hb (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of P4HB mRNA CTD PMID:22206623 P4hb Rat folpet increases expression ISO P4hb (Mus musculus) 6480464 folpet results in increased expression of P4HB mRNA CTD PMID:31558096 P4hb Rat furan affects binding EXP 6480464 furan binds to P4HB protein CTD PMID:22240984 P4hb Rat furfural multiple interactions ISO P4HB (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 P4hb Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of P4HB mRNA CTD PMID:22061828 and PMID:33387578 P4hb Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of P4HB mRNA CTD PMID:24136188 P4hb Rat glucose increases expression EXP 6480464 Glucose results in increased expression of P4HB protein CTD PMID:34801538 P4hb Rat glucose multiple interactions EXP 6480464 Chlorogenic Acid inhibits the reaction [Glucose results in increased expression of P4HB protein] and Metformin inhibits the reaction [Glucose results in increased expression of P4HB protein] CTD PMID:34801538 P4hb Rat gold atom decreases expression ISO P4hb (Mus musculus) 6480464 Gold analog results in decreased expression of P4HB protein CTD PMID:24780912 P4hb Rat gold(0) decreases expression ISO P4hb (Mus musculus) 6480464 Gold analog results in decreased expression of P4HB protein CTD PMID:24780912 P4hb Rat indinavir increases expression ISO P4HB (Homo sapiens) 6480464 Indinavir results in increased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat indometacin decreases expression ISO P4HB (Homo sapiens) 6480464 Indomethacin results in decreased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat isoprenaline increases expression ISO P4hb (Mus musculus) 6480464 Isoproterenol results in increased expression of P4HB mRNA CTD PMID:21823215 P4hb Rat ivermectin decreases expression ISO P4HB (Homo sapiens) 6480464 Ivermectin results in decreased expression of P4HB protein CTD PMID:32959892 P4hb Rat L-serine increases expression ISO P4HB (Homo sapiens) 6480464 Serine results in increased expression of P4HB protein CTD PMID:28975502 P4hb Rat manganese atom increases expression EXP 6480464 Manganese results in increased expression of P4HB mRNA CTD PMID:24777576 P4hb Rat manganese atom multiple interactions EXP 6480464 Manganese affects the reaction [P4HB protein binds to SNCA protein] and Manganese results in increased expression of and results in increased activity of P4HB protein CTD PMID:24777576 P4hb Rat manganese atom increases metabolic processing EXP 6480464 Manganese results in increased metabolism of P4HB protein CTD PMID:24777576 P4hb Rat manganese(0) increases metabolic processing EXP 6480464 Manganese results in increased metabolism of P4HB protein CTD PMID:24777576 P4hb Rat manganese(0) multiple interactions EXP 6480464 Manganese affects the reaction [P4HB protein binds to SNCA protein] and Manganese results in increased expression of and results in increased activity of P4HB protein CTD PMID:24777576 P4hb Rat manganese(0) increases expression EXP 6480464 Manganese results in increased expression of P4HB mRNA CTD PMID:24777576 P4hb Rat medroxyprogesterone acetate multiple interactions ISO P4HB (Homo sapiens) 6480464 [Estradiol co-treated with Bucladesine co-treated with Medroxyprogesterone Acetate] results in increased expression of P4HB mRNA CTD PMID:20823114 P4hb Rat metformin multiple interactions EXP 6480464 Metformin inhibits the reaction [Glucose results in increased expression of P4HB protein] CTD PMID:34801538 P4hb Rat methapyrilene increases expression EXP 6480464 Methapyrilene results in increased expression of P4HB protein CTD PMID:30467583 P4hb Rat methidathion increases expression ISO P4hb (Mus musculus) 6480464 methidathion results in increased expression of P4HB mRNA CTD PMID:34813904 P4hb Rat methotrexate affects response to substance ISO P4HB (Homo sapiens) 6480464 P4HB protein affects the susceptibility to Methotrexate CTD PMID:16217747 P4hb Rat motexafin gadolinium increases expression ISO P4HB (Homo sapiens) 6480464 motexafin gadolinium results in increased expression of P4HB mRNA CTD PMID:16357179 P4hb Rat motexafin gadolinium multiple interactions ISO P4HB (Homo sapiens) 6480464 motexafin gadolinium affects the reaction [Zinc Acetate results in increased expression of P4HB mRNA] CTD PMID:16357179 P4hb Rat N-nitrosomorpholine increases expression EXP 6480464 N-nitrosomorpholine results in increased expression of P4HB protein CTD PMID:19716841 P4hb Rat N-Phenylmaleimide decreases activity ISO P4HB (Homo sapiens) 6480464 N-phenylmaleimide analog results in decreased activity of P4HB protein CTD PMID:23384038 P4hb Rat N-Phenylmaleimide multiple interactions ISO P4HB (Homo sapiens) 6480464 N-phenylmaleimide analog inhibits the reaction [P4HB protein results in increased reduction of INS protein] CTD PMID:23384038 P4hb Rat nafenopin increases expression EXP 6480464 Nafenopin results in increased expression of P4HB protein CTD PMID:10903494 P4hb Rat naphthalene affects binding ISO P4hb (Mus musculus) 6480464 naphthalene metabolite binds to P4HB protein CTD PMID:15892573 P4hb Rat nicotine decreases expression EXP 6480464 Nicotine results in decreased expression of P4HB protein CTD PMID:28681937 P4hb Rat obeticholic acid increases expression ISO P4HB (Homo sapiens) 6480464 obeticholic acid results in increased expression of P4HB mRNA CTD PMID:27939613 P4hb Rat oxidopamine increases expression EXP 6480464 Oxidopamine results in increased expression of P4HB mRNA CTD PMID:12486162 P4hb Rat ozone multiple interactions ISO P4hb (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of P4HB mRNA CTD PMID:34911549 P4hb Rat paracetamol affects expression ISO P4hb (Mus musculus) 6480464 Acetaminophen affects the expression of P4HB mRNA CTD PMID:17562736 P4hb Rat paracetamol multiple interactions ISO P4hb (Mus musculus) 6480464 acetyl-aspartyl-glutamyl-valyl-aspartal inhibits the reaction [Acetaminophen results in increased expression of P4HB protein] CTD PMID:38042273 P4hb Rat paracetamol increases expression ISO P4hb (Mus musculus) 6480464 Acetaminophen results in increased expression of P4HB protein CTD PMID:38042273 P4hb Rat paraquat increases expression ISO P4HB (Homo sapiens) 6480464 Paraquat results in increased expression of P4HB mRNA alternative form CTD PMID:38460002 P4hb Rat pentachlorophenol multiple interactions EXP 6480464 Pentachlorophenol inhibits the reaction [Triiodothyronine and Reverse binds to P4HB protein] CTD PMID:16617682 P4hb Rat perfluorododecanoic acid decreases expression EXP 6480464 perfluorododecanoic acid results in decreased expression of P4HB protein CTD PMID:26168851 P4hb Rat phenobarbital increases expression ISO P4HB (Homo sapiens) 6480464 Phenobarbital results in increased expression of P4HB protein CTD PMID:35881160 P4hb Rat phenobarbital decreases expression ISO P4hb (Mus musculus) 6480464 Phenobarbital results in decreased expression of P4HB protein CTD PMID:35881160 P4hb Rat phenylarsonous acid decreases activity ISO P4HB (Homo sapiens) 6480464 phenylarsonous acid analog results in decreased activity of P4HB protein CTD PMID:23384038 P4hb Rat phenylarsonous acid multiple interactions ISO P4HB (Homo sapiens) 6480464 phenylarsonous acid analog inhibits the reaction [P4HB protein results in increased reduction of INS protein] CTD PMID:23384038 P4hb Rat pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of P4HB mRNA and pirinixic acid results in decreased expression of P4HB protein CTD PMID:15537571 and PMID:19162173 P4hb Rat pregnenolone 16alpha-carbonitrile increases expression EXP 6480464 Pregnenolone Carbonitrile results in increased expression of P4HB mRNA CTD PMID:19162173 P4hb Rat procymidone decreases expression EXP 6480464 procymidone results in decreased expression of P4HB mRNA CTD PMID:15686871 P4hb Rat Propiverine affects binding EXP 6480464 propiverine binds to P4HB protein CTD PMID:29273565 P4hb Rat quercetin decreases expression ISO P4HB (Homo sapiens) 6480464 Quercetin results in decreased expression of P4HB protein CTD PMID:15221776 P4hb Rat rifampicin decreases expression ISO P4HB (Homo sapiens) 6480464 Rifampin results in decreased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat S-nitrosoglutathione increases nitrosation EXP 6480464 S-Nitrosoglutathione results in increased nitrosation of P4HB protein CTD PMID:28823167 P4hb Rat sarin decreases expression ISO P4HB (Homo sapiens) 6480464 Sarin results in decreased expression of P4HB mRNA CTD PMID:19522546 P4hb Rat silicon dioxide affects secretion ISO P4HB (Homo sapiens) 6480464 Silicon Dioxide analog affects the secretion of P4HB protein CTD PMID:25895662 P4hb Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of P4HB mRNA CTD PMID:18685790 P4hb Rat simvastatin decreases expression EXP 6480464 Simvastatin results in decreased expression of P4HB mRNA CTD PMID:16414398 P4hb Rat sodium arsenite decreases expression ISO P4HB (Homo sapiens) 6480464 sodium arsenite results in decreased expression of P4HB protein CTD PMID:15899475 P4hb Rat sodium arsenite increases expression ISO P4hb (Mus musculus) 6480464 sodium arsenite results in increased expression of P4HB protein CTD PMID:29044176 P4hb Rat sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of PDI protein CTD PMID:19072884 P4hb Rat sodium chloride multiple interactions ISO P4HB (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of P4HB protein more ... CTD PMID:38598786 P4hb Rat sodium dichromate increases expression ISO P4hb (Mus musculus) 6480464 sodium bichromate results in increased expression of P4HB mRNA CTD PMID:31558096 P4hb Rat Soman increases expression EXP 6480464 Soman results in increased expression of P4HB mRNA CTD PMID:19281266 P4hb Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of P4HB mRNA CTD PMID:30047161 P4hb Rat sulforaphane affects binding ISO P4HB (Homo sapiens) 6480464 P4HB protein binds to sulforaphane CTD PMID:21838287 P4hb Rat sulindac decreases expression ISO P4HB (Homo sapiens) 6480464 Sulindac results in decreased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat T-2 toxin affects expression EXP 6480464 T-2 Toxin affects the expression of P4HB protein CTD PMID:26141394 P4hb Rat tamoxifen affects expression ISO P4hb (Mus musculus) 6480464 Tamoxifen affects the expression of P4HB mRNA CTD PMID:17555576 P4hb Rat testosterone affects expression ISO P4hb (Mus musculus) 6480464 Testosterone affects the expression of P4HB mRNA CTD PMID:17003280 P4hb Rat testosterone decreases expression ISO P4hb (Mus musculus) 6480464 Testosterone deficiency results in decreased expression of P4HB mRNA CTD PMID:33848595 P4hb Rat Tetrachlorobisphenol A multiple interactions EXP 6480464 tetrachlorodian inhibits the reaction [Triiodothyronine and Reverse binds to P4HB protein] CTD PMID:16617682 P4hb Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of P4HB protein CTD PMID:18930782 P4hb Rat tetrachloromethane increases expression ISO P4hb (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of P4HB mRNA CTD PMID:31919559 P4hb Rat thapsigargin increases expression ISO P4HB (Homo sapiens) 6480464 Thapsigargin results in increased expression of P4HB mRNA CTD PMID:22378314 more ... P4hb Rat thapsigargin increases expression EXP 6480464 Thapsigargin results in increased expression of P4HB protein CTD PMID:35544339 P4hb Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of P4HB mRNA CTD PMID:34492290 P4hb Rat titanium dioxide multiple interactions ISO P4hb (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of P4HB mRNA CTD PMID:29950665 P4hb Rat titanium dioxide decreases methylation ISO P4hb (Mus musculus) 6480464 titanium dioxide results in decreased methylation of P4HB gene CTD PMID:35295148 P4hb Rat toxoflavin multiple interactions ISO P4hb (Mus musculus) 6480464 toxoflavin analog inhibits the reaction [[Dexamethasone co-treated with TNFSF11 protein] results in increased expression of P4HB protein] CTD PMID:39393751 P4hb Rat triadimefon increases expression EXP 6480464 triadimefon results in increased expression of P4HB mRNA CTD PMID:30047161 P4hb Rat troglitazone increases expression ISO P4HB (Homo sapiens) 6480464 Troglitazone results in increased expression of P4HB mRNA CTD PMID:32535746 P4hb Rat tunicamycin increases expression ISO P4hb (Mus musculus) 6480464 Tunicamycin results in increased expression of P4HB protein CTD PMID:32740777 P4hb Rat tunicamycin increases expression ISO P4HB (Homo sapiens) 6480464 Tunicamycin results in increased expression of P4HB mRNA and Tunicamycin results in increased expression of P4HB protein CTD PMID:15049342 more ... P4hb Rat valproic acid decreases expression ISO P4HB (Homo sapiens) 6480464 Valproic Acid results in decreased expression of P4HB mRNA CTD PMID:29501571 P4hb Rat vanadium atom decreases expression ISO P4HB (Homo sapiens) 6480464 Vanadium results in decreased expression of P4HB mRNA CTD PMID:19000753 P4hb Rat vanadium(0) decreases expression ISO P4HB (Homo sapiens) 6480464 Vanadium results in decreased expression of P4HB mRNA CTD PMID:19000753 P4hb Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of P4HB mRNA CTD PMID:15686871 P4hb Rat zearalenone multiple interactions ISO P4hb (Mus musculus) 6480464 [Zearalenone co-treated with CGA protein] results in decreased expression of P4HB protein CTD PMID:25058043 P4hb Rat zinc acetate multiple interactions ISO P4HB (Homo sapiens) 6480464 motexafin gadolinium affects the reaction [Zinc Acetate results in increased expression of P4HB mRNA] CTD PMID:16357179 P4hb Rat zinc acetate increases expression ISO P4HB (Homo sapiens) 6480464 Zinc Acetate results in increased expression of P4HB mRNA CTD PMID:16357179 P4hb Rat zinc atom affects binding ISO P4HB (Homo sapiens) 6480464 P4HB protein binds to Zinc CTD PMID:14534351 P4hb Rat zinc atom increases expression ISO P4HB (Homo sapiens) 6480464 Zinc deficiency results in increased expression of P4HB mRNA CTD PMID:22171008 P4hb Rat zinc(0) affects binding ISO P4HB (Homo sapiens) 6480464 P4HB protein binds to Zinc CTD PMID:14534351 P4hb Rat zinc(0) increases expression ISO P4HB (Homo sapiens) 6480464 Zinc deficiency results in increased expression of P4HB mRNA CTD PMID:22171008 P4hb Rat zoledronic acid increases expression ISO P4HB (Homo sapiens) 6480464 zoledronic acid results in increased expression of P4HB mRNA CTD PMID:20977926
Imported Annotations - KEGG (archival)
(+)-catechin (ISO) (-)-epigallocatechin 3-gallate (ISO) (S)-nicotine (EXP) 1,2-dimethylhydrazine (ISO) 1,3-dinitrobenzene (EXP) 1-chloro-2,4-dinitrobenzene (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 2,4-dichlorophenol (EXP) 2,6-dimethoxyphenol (ISO) 2-methyl-2-[4-(1,2,3,4-tetrahydronaphthalen-1-yl)phenoxy]propanoic acid (EXP) 3,3',5'-triiodo-L-thyronine (EXP) 3,3',5,5'-tetrabromobisphenol A (EXP,ISO) 3,3',5-triiodo-L-thyronine (EXP) 3,4-methylenedioxymethamphetamine (EXP) 3-chloropropane-1,2-diol (EXP) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxynon-2-enal (EXP) 4-hydroxyphenyl retinamide (ISO) 4-nonylphenol (EXP) 4-octylphenol (EXP) 5-azacytidine (EXP,ISO) 5-fluorouracil (ISO) 6-propyl-2-thiouracil (EXP) aldehydo-D-glucose (EXP) all-trans-retinoic acid (ISO) allopurinol (ISO) amitrole (EXP) ammonium chloride (EXP) aristolochic acid A (ISO) Aroclor 1254 (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) Azoxymethane (ISO) benzatropine (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bexarotene (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) bleomycin A2 (EXP) Brodifacoum (EXP) bromobenzene (EXP) bucladesine (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcidiol (EXP) calcitriol (EXP) calcium atom (EXP) calcium(0) (EXP) captan (ISO) carbon nanotube (ISO) chlorogenic acid (EXP) chloropicrin (ISO) cisplatin (ISO) clobetasol (ISO) clofibrate (EXP) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) coumestrol (ISO) CU-O LINKAGE (ISO) cyclosporin A (ISO) cylindrospermopsin (ISO) D-glucose (EXP) dexamethasone (ISO) dextran sulfate (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) diclofenac (EXP) doxorubicin (ISO) endosulfan (EXP) Enterolactone (ISO) ethanol (ISO) fenofibrate (EXP) fenthion (ISO) fluoxetine (EXP) folic acid (ISO) folpet (ISO) furan (EXP) furfural (ISO) gentamycin (EXP) glafenine (EXP) glucose (EXP) gold atom (ISO) gold(0) (ISO) indinavir (ISO) indometacin (ISO) isoprenaline (ISO) ivermectin (ISO) L-serine (ISO) manganese atom (EXP) manganese(0) (EXP) medroxyprogesterone acetate (ISO) metformin (EXP) methapyrilene (EXP) methidathion (ISO) methotrexate (ISO) motexafin gadolinium (ISO) N-nitrosomorpholine (EXP) N-Phenylmaleimide (ISO) nafenopin (EXP) naphthalene (ISO) nicotine (EXP) obeticholic acid (ISO) oxidopamine (EXP) ozone (ISO) paracetamol (ISO) paraquat (ISO) pentachlorophenol (EXP) perfluorododecanoic acid (EXP) phenobarbital (ISO) phenylarsonous acid (ISO) pirinixic acid (EXP) pregnenolone 16alpha-carbonitrile (EXP) procymidone (EXP) Propiverine (EXP) quercetin (ISO) rifampicin (ISO) S-nitrosoglutathione (EXP) sarin (ISO) silicon dioxide (EXP,ISO) simvastatin (EXP) sodium arsenite (EXP,ISO) sodium chloride (ISO) sodium dichromate (ISO) Soman (EXP) sulfadimethoxine (EXP) sulforaphane (ISO) sulindac (ISO) T-2 toxin (EXP) tamoxifen (ISO) testosterone (ISO) Tetrachlorobisphenol A (EXP) tetrachloromethane (EXP,ISO) thapsigargin (EXP,ISO) thioacetamide (EXP) titanium dioxide (ISO) toxoflavin (ISO) triadimefon (EXP) troglitazone (ISO) tunicamycin (ISO) valproic acid (ISO) vanadium atom (ISO) vanadium(0) (ISO) vinclozolin (EXP) zearalenone (ISO) zinc acetate (ISO) zinc atom (ISO) zinc(0) (ISO) zoledronic acid (ISO)
Biological Process
cellular response to hypoxia (IEA,ISO) cellular response to interleukin-7 (IEA,ISO) endoplasmic reticulum to Golgi vesicle-mediated transport (IEA,ISO) insulin processing (IEA,ISO) peptidyl-proline hydroxylation to 4-hydroxy-L-proline (ISO) positive regulation of cell adhesion (IEA,ISO) positive regulation of substrate adhesion-dependent cell spreading (IEA,ISO) positive regulation of T cell migration (IEA,ISO) positive regulation of viral entry into host cell (IEA,ISO) protein folding (IBA) protein folding in endoplasmic reticulum (IEA,ISO) regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (IEA,ISO) response to endoplasmic reticulum stress (IBA,IEA,ISO)
Cellular Component
cytoskeleton (IEA,ISO) cytosol (IEA,ISO) endoplasmic reticulum (IBA,IEA,ISO,ISS) endoplasmic reticulum chaperone complex (IEA,ISO) endoplasmic reticulum lumen (IEA,ISO) endoplasmic reticulum-Golgi intermediate compartment (IEA,ISO) external side of plasma membrane (IBA,IEA,ISO) lamellipodium (IEA,ISO) melanosome (IEA) membrane (IEA) plasma membrane (IEA) procollagen-proline 4-dioxygenase complex (IEA,ISO) protein-containing complex (IEA,ISO)
1.
Nucleotide sequence of rat liver iodothyronine 5'-monodeiodinase (5' MD): its identity with the protein disulfide isomerase.
Boado RJ, etal., Biochem Biophys Res Commun 1988 Sep 30;155(3):1297-304.
2.
Enzyme binding-inhibiting assay for iodothyronine 5'-monodeiodinase (5'-MD) and its application to isolation of complementary deoxyribonucleic acid clones for the 5'-MD in rat liver.
Boado RJ, etal., Endocrinology 1988 Sep;123(3):1264-73.
3.
SOD1 aggregation in astrocytes following ischemia/reperfusion injury: a role of NO-mediated S-nitrosylation of protein disulfide isomerase (PDI).
Chen X, etal., J Neuroinflammation. 2012 Oct 12;9:237. doi: 10.1186/1742-2094-9-237.
4.
Sequence of protein disulphide isomerase and implications of its relationship to thioredoxin.
Edman JC, etal., Nature 1985 Sep 19-25;317(6034):267-70.
5.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
6.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
7.
Localization of microsomal triglyceride transfer protein in the Golgi: possible role in the assembly of chylomicrons.
Levy E, etal., J Biol Chem. 2002 May 10;277(19):16470-7. Epub 2002 Feb 5.
8.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
9.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
10.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
11.
GOA pipeline
RGD automated data pipeline
12.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
13.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
14.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
P4hb Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 106,335,300 - 106,346,911 (-) NCBI GRCr8 mRatBN7.2 10 105,836,972 - 105,848,583 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 105,836,982 - 105,848,500 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 110,941,098 - 110,952,604 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 110,404,126 - 110,415,632 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 105,757,420 - 105,769,031 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 109,736,459 - 109,748,070 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 109,736,458 - 109,747,987 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 109,329,596 - 109,341,091 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 109,950,221 - 109,961,716 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 109,964,724 - 109,976,220 (-) NCBI Celera 10 104,380,384 - 104,391,995 (-) NCBI Celera Cytogenetic Map 10 q32.3 NCBI
P4HB Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 81,843,166 - 81,860,535 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 81,843,159 - 81,860,856 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 79,801,042 - 79,818,411 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 77,394,323 - 77,411,833 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 17 76,404,498 - 76,422,010 (-) NCBI Celera Cytogenetic Map 17 q25.3 NCBI HuRef 17 75,202,821 - 75,220,332 (-) NCBI HuRef CHM1_1 17 79,887,239 - 79,904,780 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 82,710,331 - 82,727,700 (-) NCBI T2T-CHM13v2.0
P4hb Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 120,451,124 - 120,464,079 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 120,451,124 - 120,464,079 (-) Ensembl GRCm39 Ensembl GRCm38 11 120,560,298 - 120,573,253 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 120,560,298 - 120,573,253 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 120,421,618 - 120,434,250 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 120,376,394 - 120,389,026 (-) NCBI MGSCv36 mm8 Celera 11 132,295,664 - 132,308,296 (-) NCBI Celera Cytogenetic Map 11 E2 NCBI cM Map 11 84.27 NCBI
P4hb Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955506 1,307,932 - 1,324,027 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955506 1,307,932 - 1,322,011 (+) NCBI ChiLan1.0 ChiLan1.0
P4HB Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 98,378,767 - 98,396,916 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 103,279,545 - 103,297,401 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 76,248,252 - 76,266,152 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 81,950,826 - 81,968,329 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 81,950,422 - 81,968,109 (-) Ensembl panpan1.1 panPan2
P4HB Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 427,827 - 436,880 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 427,830 - 436,064 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 1,029,990 - 1,039,034 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 1,021,195 - 1,030,242 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 1,021,122 - 1,030,242 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 1,046,356 - 1,055,402 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 1,172,930 - 1,181,988 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 1,251,854 - 1,260,908 (+) NCBI UU_Cfam_GSD_1.0
P4hb Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 1,032,744 - 1,043,760 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936594 5,367,816 - 5,379,252 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936594 5,368,199 - 5,379,215 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
P4HB
P4HB Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 73,718,743 - 73,733,488 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 73,718,656 - 73,733,892 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 45,170,359 - 45,185,570 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
P4hb
.
Assembly: Rnor_5.0
Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Strain Variant Page
10
109339931
109339932
G
T
snv
ZF (KyushuU) View more Information
Predicted Target Of
Count of predictions: 310 Count of miRNA genes: 192 Interacting mature miRNAs: 217 Transcripts: ENSRNOT00000054958 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 12880384 Cm107 Cardiac mass QTL 107 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 90404397 107211142 Rat 12880385 Cm108 Cardiac mass QTL 108 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 90404397 107211142 Rat 1354641 Bvd2 Brain ventricular dilatation QTL 2 6.36 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 10 93223816 107057807 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 2303589 Bw87 Body weight QTL 87 2 body mass (VT:0001259) body weight (CMO:0000012) 10 81285008 107211142 Rat 12880396 Am13 Aortic mass QTL 13 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 90404397 107211142 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 12880398 Kidm67 Kidney mass QTL 67 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 10 90404397 107211142 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 12880395 Cm109 Cardiac mass QTL 109 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 10 90404397 107211142 Rat 1579915 Bp280 Blood pressure QTL 280 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90404397 107211142 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 2298548 Neuinf7 Neuroinflammation QTL 7 3.4 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 10 72224939 107211142 Rat 1302404 Cia27 Collagen induced arthritis QTL 27 2.6 0.0045 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 10 76452683 107211142 Rat 2317754 Glom25 Glomerulus QTL 25 3.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 82685200 107211142 Rat 634320 Niddm49 Non-insulin dependent diabetes mellitus QTL 49 4.41 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 10 88539139 107211142 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 4889492 Pancm2 Pancreatic morphology QTL 2 3.2 pancreatic beta cell morphology trait (VT:0005217) ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814) 10 76748906 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 10450493 Bp382 Blood pressure QTL 382 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 1578672 Bmd16 Bone mineral density QTL 16 6.2 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 10 96703043 107057807 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 70193 Mcs7 Mammary carcinoma susceptibility QTL 7 2.38 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 72224939 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 61363 Oia3 Oil induced arthritis QTL 3 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87307617 107211142 Rat 2292438 Bp311 Blood pressure QTL 311 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 107211142 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 2292436 Bp310 Blood pressure QTL 310 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 724530 Bp149 Blood pressure QTL 149 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90627439 107211142 Rat 1300137 Bp186 Blood pressure QTL 186 3.57 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 10 90627439 107057807 Rat 631538 Oia5 Oil induced arthritis QTL 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87055121 107211142 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 1578663 Bss18 Bone structure and strength QTL 18 3.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 10 96703043 107057807 Rat
RH129632
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 105,837,024 - 105,837,226 (+) MAPPER mRatBN7.2 Rnor_6.0 10 109,736,512 - 109,736,713 NCBI Rnor6.0 Rnor_5.0 10 109,329,641 - 109,329,842 UniSTS Rnor5.0 RGSC_v3.4 10 109,950,266 - 109,950,467 UniSTS RGSC3.4 Celera 10 104,380,437 - 104,380,638 UniSTS Cytogenetic Map 10 q32.3 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000054958 ⟹ ENSRNOP00000051841
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 105,836,982 - 105,848,500 (-) Ensembl Rnor_6.0 Ensembl 10 109,736,458 - 109,747,987 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000100112 ⟹ ENSRNOP00000086980
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 105,836,982 - 105,848,434 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106240 ⟹ ENSRNOP00000084686
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 105,836,982 - 105,848,261 (-) Ensembl
RefSeq Acc Id:
NM_012998 ⟹ NP_037130
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 106,335,300 - 106,346,911 (-) NCBI mRatBN7.2 10 105,836,972 - 105,848,583 (-) NCBI Rnor_6.0 10 109,736,459 - 109,748,070 (-) NCBI Rnor_5.0 10 109,329,596 - 109,341,091 (-) NCBI RGSC_v3.4 10 109,950,221 - 109,961,716 (-) RGD Celera 10 104,380,384 - 104,391,995 (-) NCBI
Sequence:
GGCAGGTGACGCGCGCAGTAAGGGGGAGGCGTGGGCGCGTCCCCGACCCAGGATTTATAAAGGCGAGGTCTGGACCGACGCGCGCTCTCGTCGCCTTGGCTGTCCCGGCGGCGCCAACCTAGCTGCCC
hide sequence
RefSeq Acc Id:
NP_037130 ⟸ NM_012998
- Peptide Label:
precursor
- UniProtKB:
P13700 (UniProtKB/Swiss-Prot), P04785 (UniProtKB/Swiss-Prot), A6HLE8 (UniProtKB/TrEMBL), A0A8I6A1R9 (UniProtKB/TrEMBL)
- Sequence:
MLSRALLCLALAWAARVGADALEEEDNVLVLKKSNFAEALAAHNYLLVEFYAPWCGHCKALAPEYAKAAAKLKAEGSEIRLAKVDATEESDLAQQYGVRGYPTIKFFKNGDTASPKEYTAGREADDIV
hide sequence
Ensembl Acc Id:
ENSRNOP00000051841 ⟸ ENSRNOT00000054958
Ensembl Acc Id:
ENSRNOP00000086980 ⟸ ENSRNOT00000100112
Ensembl Acc Id:
ENSRNOP00000084686 ⟸ ENSRNOT00000106240
RGD ID: 13697964 Promoter ID: EPDNEW_R8488 Type: initiation region Name: P4hb_1 Description: prolyl 4-hydroxylase subunit beta SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 109,747,987 - 109,748,047 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-03
P4hb
prolyl 4-hydroxylase subunit beta
P4hb
prolyl 4-hydroxylase, beta polypeptide
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2002-06-10
P4hb
Protein disulfide isomerase (Prolyl 4-hydroxylase, beta polypeptide)
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
expressed in liver
633506
