Symbol:
GLRX5
Name:
glutaredoxin 5
RGD ID:
18441883
Description:
ENCODES a protein that exhibits 2 iron, 2 sulfur cluster binding (inferred); iron-sulfur cluster binding (inferred); metal ion binding (inferred); INVOLVED IN [2Fe-2S] cluster assembly (inferred); protein maturation (inferred); PARTICIPATES IN mitochondrial iron-sulfur cluster protein biogenesis pathway; ASSOCIATED WITH autosomal recessive pyridoxine-refractory sideroblastic anemia 2 (ortholog); autosomal recessive pyridoxine-refractory sideroblastic anemia 3 (ortholog); Childhood-Onset Spasticity with Hyperglycinemia (ortholog); FOUND IN dendrite (ortholog); neuronal cell body (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
glutaredoxin-related protein 5, mitochondrial
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
GLRX5 (glutaredoxin 5) NCBI
Ortholog
Mus musculus (house mouse):
Glrx5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Rattus norvegicus (Norway rat):
Glrx5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Glrx5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
GLRX5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
GLRX5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
GLRX5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Glrx5 (glutaredoxin 5) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 24 73,387,941 - 73,398,208 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 24 73,387,641 - 73,398,233 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666053 60,564,346 - 60,574,102 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
GLRX5 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 24 73,387,941 - 73,398,208 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 24 73,387,641 - 73,398,233 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666053 60,564,346 - 60,574,102 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
GLRX5 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 14 95,535,050 - 95,544,714 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 14 95,533,503 - 95,544,724 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 14 96,001,387 - 96,011,051 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 14 95,071,076 - 95,080,808 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 14 95,071,075 - 95,080,808 NCBI Celera 14 76,057,010 - 76,066,743 (+) NCBI Celera Cytogenetic Map 14 q32.13 NCBI HuRef 14 76,186,979 - 76,196,711 (+) NCBI HuRef CHM1_1 14 95,939,246 - 95,948,981 (+) NCBI CHM1_1 T2T-CHM13v2.0 14 89,765,742 - 89,775,402 (+) NCBI T2T-CHM13v2.0
Glrx5 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 12 104,998,877 - 105,007,170 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 12 104,998,947 - 105,009,165 (+) Ensembl GRCm39 Ensembl GRCm38 12 105,032,618 - 105,040,911 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 12 105,032,688 - 105,042,906 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 12 106,270,899 - 106,279,120 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 12 105,433,739 - 105,441,960 (+) NCBI MGSCv36 mm8 Celera 12 106,265,134 - 106,273,355 (+) NCBI Celera Cytogenetic Map 12 E NCBI cM Map 12 55.04 NCBI
Glrx5 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 6 129,752,902 - 129,763,278 (+) NCBI GRCr8 mRatBN7.2 6 123,988,461 - 123,998,545 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 6 123,988,134 - 123,998,545 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 6 124,118,169 - 124,128,237 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 6 124,413,421 - 124,423,489 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 6 123,785,337 - 123,795,417 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 6 128,750,503 - 128,760,880 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 6 128,750,795 - 128,760,880 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 6 137,947,583 - 137,957,960 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 6 129,233,209 - 129,243,293 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 6 129,236,842 - 129,245,795 (+) NCBI Celera 6 121,459,083 - 121,469,162 (+) NCBI Celera Cytogenetic Map 6 q32 NCBI
Glrx5 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955438 17,066,955 - 17,075,789 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955438 17,067,017 - 17,076,162 (-) NCBI ChiLan1.0 ChiLan1.0
GLRX5 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 15 96,688,753 - 96,698,490 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 14 95,905,267 - 95,914,996 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 14 76,162,541 - 76,172,291 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 14 95,486,818 - 95,496,438 (+) NCBI panpan1.1 PanPan1.1 panPan2
GLRX5 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 8 64,383,203 - 64,392,886 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 8 64,383,227 - 64,383,841 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 8 63,961,948 - 63,972,042 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 8 64,651,949 - 64,662,047 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 8 64,652,309 - 64,662,049 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 8 64,326,648 - 64,336,722 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 8 64,385,664 - 64,395,761 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 8 64,710,831 - 64,720,934 (+) NCBI UU_Cfam_GSD_1.0
GLRX5 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 116,787,432 - 116,800,554 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 116,787,346 - 116,797,477 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 124,001,745 - 124,011,835 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Glrx5
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000008725 ⟹ ENSCSAP00000006862
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 24 73,387,641 - 73,398,233 (+) Ensembl
RefSeq Acc Id:
XM_007987747 ⟹ XP_007985938
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 24 73,387,941 - 73,398,208 (+) NCBI Vero_WHO_p1.0 NW_023666053 60,564,346 - 60,574,102 (+) NCBI
Sequence:
GGGTCTCCAGGGGGTGGGTCGAACTGCCGCGGGCCGGGAAGCGCTCCGGGTGGCCAGCTGTGTGCCCAGGCTCTCGTGGGTTCCGGCGAGCGTGCGGAGATGAGCGGGTCCCTCGGCCGAGCGGCGGC
hide sequence
RefSeq Acc Id:
XP_007985938 ⟸ XM_007987747
- UniProtKB:
A0A0D9RE23 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000006862 ⟸ ENSCSAT00000008725
