Symbol:
Gnrh1
Name:
gonadotropin releasing hormone 1
RGD ID:
1553302
MGI Page
MGI
Description:
Predicted to enable gonadotropin hormone-releasing hormone activity and gonadotropin-releasing hormone receptor binding activity. Acts upstream of or within several processes, including negative regulation of neuron migration; regulation of ovarian follicle development; and response to ethanol. Located in extracellular space. Is expressed in several structures, including alimentary system; nervous system; olfactory system; and testis. Used to study hypogonadotropic hypogonadism 12 with or without anosmia. Human ortholog(s) of this gene implicated in breast cancer; hypogonadotropic hypogonadism 12 with or without anosmia; and periodontitis. Orthologous to human GNRH1 (gonadotropin releasing hormone 1).
Type:
protein-coding
RefSeq Status:
REVIEWED
Previously known as:
Gnrh; Gnrh2; gonadotropin releasing hormone 2; hpg; hypogonadal; L; LH; LHRH; Lhrh1; Lnrh; luteinizing hormone-releasing hormone I; progonadoliberin I; progonadoliberin-1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
GNRH1 (gonadotropin releasing hormone 1)
HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Gnrh1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Gnrh1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
GNRH1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
GNRH1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Gnrh1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
GNRH1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
GNRH1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Gnrh1 (gonadotropin releasing hormone 1)
Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Gnrh1 (gonadotropin releasing hormone 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
GNRH1 (gonadotropin releasing hormone 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
gnrh3 (gonadotropin-releasing hormone 3)
Alliance
DIOPT (Ensembl Compara|PANTHER)
Xenopus tropicalis (tropical clawed frog):
gnrh1
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 67,982,717 - 67,986,889 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 67,982,630 - 67,986,888 (+) Ensembl GRCm39 Ensembl GRCm38 14 67,745,181 - 67,749,440 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 67,745,181 - 67,749,439 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 68,363,286 - 68,367,493 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 66,699,676 - 66,702,621 (+) NCBI MGSCv36 mm8 Celera 14 65,502,860 - 65,507,056 (+) NCBI Celera Cytogenetic Map 14 D1 NCBI cM Map 14 34.66 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gnrh1 Mouse (-)-epigallocatechin 3-gallate multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of GNRH1 mRNA CTD PMID:22079256 Gnrh1 Mouse 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane decreases expression EXP 6480464 2 more ... CTD PMID:10537130 Gnrh1 Mouse 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 o and p'-DDT affects the reaction [LHB protein results in increased susceptibility to GNRH1 protein] CTD PMID:17596564 Gnrh1 Mouse 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 o and p'-DDT affects the secretion of GNRH1 protein CTD PMID:17596564 Gnrh1 Mouse 1,2-dichloroethane increases expression EXP 6480464 ethylene dichloride results in increased expression of GNRH1 protein CTD PMID:28973639 Gnrh1 Mouse 17beta-estradiol multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [Progesterone co-treated with Estradiol] results in increased secretion of GNRH1 protein more ... CTD PMID:10566683 and PMID:17054466 Gnrh1 Mouse 17beta-estradiol decreases expression ISO GNRH1 (Homo sapiens) 6480464 Estradiol results in decreased expression of GNRH1 mRNA CTD PMID:31614463 Gnrh1 Mouse 17beta-estradiol affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Estradiol affects the secretion of GNRH1 protein CTD PMID:17596564 Gnrh1 Mouse 17beta-estradiol multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Estradiol affects the reaction [LHB protein results in increased susceptibility to GNRH1 protein] CTD PMID:17596564 Gnrh1 Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of GNRH1 mRNA CTD PMID:10537130 Gnrh1 Mouse 17beta-estradiol multiple interactions EXP 6480464 Estradiol inhibits the reaction [ESR2 protein alternative form results in increased expression of GNRH1 mRNA] and fulvestrant inhibits the reaction [Estradiol results in decreased expression of GNRH1 mRNA] CTD PMID:10537130 and PMID:16439454 Gnrh1 Mouse 17beta-estradiol 3-benzoate multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with GNRH1 protein] results in increased secretion of LH protein CTD PMID:19574278 Gnrh1 Mouse 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 1H-(1 more ... CTD PMID:17110411 Gnrh1 Mouse 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,2',4,4',5,5'-hexachlorobiphenyl affects expression EXP 6480464 2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 2 more ... CTD PMID:27291303 Gnrh1 Mouse 2,2',4,5-tetrachlorobiphenyl affects expression EXP 6480464 2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,2',4,5-tetrachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,3',4,4',5-Pentachlorobiphenyl affects expression EXP 6480464 2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,3',4,4',5-Pentachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:19362103 Gnrh1 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to GNRH1 promoter] CTD PMID:19654925 Gnrh1 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of GNRH1 mRNA CTD PMID:33387578 Gnrh1 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of GNRH1 mRNA CTD PMID:23871856 Gnrh1 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 AHR gene mutant form promotes the reaction [Tetrachlorodibenzodioxin results in increased expression of GNRH1 mRNA] and Tetrachlorodibenzodioxin inhibits the reaction [GNRH1 protein results in increased expression of LHB mRNA] CTD PMID:21467749 and PMID:23871856 Gnrh1 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased secretion of GNRH1 protein CTD PMID:19490993 Gnrh1 Mouse 3',5'-cyclic GMP multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [manganese chloride results in increased chemical synthesis of Cyclic GMP] which results in increased secretion of GNRH1 protein CTD PMID:17110411 and PMID:17290048 Gnrh1 Mouse 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Puromycin Aminonucleoside inhibits the reaction [GNRH1 protein results in increased secretion of FSHB protein] and Puromycin Aminonucleoside inhibits the reaction [GNRH1 protein results in increased secretion of LHB protein] CTD PMID:12269381 Gnrh1 Mouse 4,4'-sulfonyldiphenol affects expression ISO GNRH1 (Homo sapiens) 6480464 bisphenol S affects the expression of GNRH1 mRNA CTD PMID:38301581 Gnrh1 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of GNRH1 mRNA CTD PMID:39298647 Gnrh1 Mouse acetamide decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 acetamide results in decreased expression of GNRH1 mRNA CTD PMID:31881176 Gnrh1 Mouse acrylamide decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Acrylamide results in decreased expression of GNRH1 protein CTD PMID:38614435 Gnrh1 Mouse alfuzosin multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 alfuzosin inhibits the reaction [Phenylephrine results in decreased secretion of GNRH1 protein] and alfuzosin inhibits the reaction [Phenylephrine results in increased secretion of GNRH1 protein] CTD PMID:1975657 Gnrh1 Mouse allethrin multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of GNRH1 protein CTD PMID:34896426 Gnrh1 Mouse alpha-Zearalanol multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of GNRH1 mRNA CTD PMID:35163327 Gnrh1 Mouse ammonium chloride affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of GNRH1 mRNA CTD PMID:16483693 Gnrh1 Mouse atrazine multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 GNRH1 protein inhibits the reaction [Atrazine results in decreased secretion of LHB protein] CTD PMID:10696778 Gnrh1 Mouse atrazine decreases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Atrazine results in decreased secretion of GNRH protein CTD PMID:23197165 Gnrh1 Mouse atrazine increases expression ISO GNRH1 (Homo sapiens) 6480464 Atrazine results in increased expression of GNRH1 mRNA CTD PMID:22378314 Gnrh1 Mouse benzo[a]pyrene increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Benzo(a)pyrene results in increased expression of GNRH1 mRNA CTD PMID:21839799 Gnrh1 Mouse beta-hexachlorocyclohexane multiple interactions EXP 6480464 [Dichlorodiphenyl Dichloroethylene co-treated with beta-hexachlorocyclohexane] results in increased expression of GNRH1 mRNA CTD PMID:16758953 Gnrh1 Mouse bicuculline multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Bicuculline affects the reaction [bisphenol A affects the secretion of GNRH1 protein] and Bicuculline promotes the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:18603625 and PMID:26950200 Gnrh1 Mouse bifenthrin increases expression ISO GNRH1 (Homo sapiens) 6480464 bifenthrin results in increased expression of GNRH1 mRNA CTD PMID:24938463 Gnrh1 Mouse bis(2-ethylhexyl) phthalate multiple interactions EXP 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate] results in decreased expression of GNRH1 mRNA CTD PMID:22828881 Gnrh1 Mouse bis(2-ethylhexyl) phthalate affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 Diethylhexyl Phthalate affects the expression of GNRH mRNA CTD PMID:32209209 Gnrh1 Mouse bis(2-ethylhexyl) phthalate decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Diethylhexyl Phthalate results in decreased expression of GNRH1 protein CTD PMID:30090590 Gnrh1 Mouse bis(2-ethylhexyl) phthalate increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Diethylhexyl Phthalate results in increased expression of GNRH mRNA more ... CTD PMID:24675100 and PMID:34049116 Gnrh1 Mouse bisphenol A multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Bicuculline affects the reaction [bisphenol A affects the secretion of GNRH1 protein] more ... CTD PMID:19479018 more ... Gnrh1 Mouse bisphenol A decreases expression ISO GNRH1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of GNRH1 mRNA CTD PMID:31715268 Gnrh1 Mouse bisphenol A increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of GNRH1 mRNA and bisphenol A results in increased expression of GNRH1 protein CTD PMID:28641706 more ... Gnrh1 Mouse bisphenol A affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 bisphenol A affects the expression of GNRH1 mRNA CTD PMID:20951796 and PMID:25181051 Gnrh1 Mouse bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of GNRH1 mRNA CTD PMID:23185968 more ... Gnrh1 Mouse bisphenol A affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 bisphenol A affects the secretion of GNRH1 protein CTD PMID:19479018 more ... Gnrh1 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of GNRH1 mRNA and bisphenol A results in increased expression of GNRH1 protein CTD PMID:21182934 more ... Gnrh1 Mouse bisphenol A decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of GNRH1 mRNA CTD PMID:23554804 more ... Gnrh1 Mouse bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate] results in decreased expression of GNRH1 mRNA more ... CTD PMID:22828881 more ... Gnrh1 Mouse bisphenol F decreases expression EXP 6480464 bisphenol F results in decreased expression of GNRH1 mRNA CTD PMID:38685157 Gnrh1 Mouse bisphenol F decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 bisphenol F results in decreased expression of GNRH1 protein CTD PMID:37601897 Gnrh1 Mouse cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of GNRH1 mRNA CTD PMID:31014900 Gnrh1 Mouse cadmium dichloride multiple interactions EXP 6480464 cyanidin-3-O-beta-glucopyranoside inhibits the reaction [Cadmium Chloride results in increased expression of GNRH1 mRNA] CTD PMID:31014900 Gnrh1 Mouse calcium dichloride multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [manganese chloride co-treated with Calcium Chloride] results in increased secretion of GNRH1 protein CTD PMID:18603625 Gnrh1 Mouse carvone increases secretion ISO GNRH1 (Homo sapiens) 6480464 carvone results in increased secretion of GNRH1 protein CTD PMID:10566683 Gnrh1 Mouse carvone increases expression ISO GNRH1 (Homo sapiens) 6480464 carvone results in increased expression of GNRH1 mRNA CTD PMID:10566683 Gnrh1 Mouse chlormequat chloride increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Chlormequat results in increased expression of GNRH1 protein CTD PMID:29447956 Gnrh1 Mouse chlorpyrifos affects expression EXP 6480464 Chlorpyrifos affects the expression of GNRH1 mRNA CTD PMID:12088877 Gnrh1 Mouse chlorpyrifos affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 Chlorpyrifos affects the expression of GNRH1 mRNA CTD PMID:11394642 Gnrh1 Mouse chlorpyrifos multiple interactions EXP 6480464 fulvestrant inhibits the reaction [Chlorpyrifos results in increased secretion of GNRH1 protein] CTD PMID:12088877 Gnrh1 Mouse chlorpyrifos increases secretion EXP 6480464 Chlorpyrifos results in increased secretion of GNRH1 protein CTD PMID:12088877 Gnrh1 Mouse chromium(6+) multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Potassium Dichromate results in increased abundance of chromium hexavalent ion] which results in decreased expression of GNRH1 protein CTD PMID:38532648 Gnrh1 Mouse cisplatin decreases expression ISO GNRH1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of GNRH1 mRNA CTD PMID:27594783 Gnrh1 Mouse clomiphene multiple interactions ISO GNRH1 (Homo sapiens) 6480464 Clomiphene inhibits the reaction [Estradiol promotes the reaction [GNRH1 protein results in increased secretion of PRL protein]] CTD PMID:17054466 Gnrh1 Mouse cocaine decreases expression EXP 6480464 Cocaine results in decreased expression of GNRH1 protein CTD PMID:31059705 Gnrh1 Mouse cocaine multiple interactions EXP 6480464 GPX1 protein inhibits the reaction [Cocaine results in decreased expression of GNRH1 protein] and prolinedithiocarbamate inhibits the reaction [Cocaine results in decreased expression of GNRH1 protein] CTD PMID:31059705 Gnrh1 Mouse cyclophosphamide multiple interactions EXP 6480464 Flavonoids inhibits the reaction [Cyclophosphamide results in decreased secretion of GNRH1 protein] CTD PMID:39239657 Gnrh1 Mouse cyclophosphamide decreases secretion EXP 6480464 Cyclophosphamide results in decreased secretion of GNRH1 protein CTD PMID:39239657 Gnrh1 Mouse cyhalothrin multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of GNRH1 protein CTD PMID:34896426 Gnrh1 Mouse cypermethrin affects secretion EXP 6480464 cypermethrin affects the secretion of GNRH1 protein CTD PMID:28731686 Gnrh1 Mouse cypermethrin multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of GNRH1 protein and [cypermethrin co-treated with emamectin benzoate] results in decreased expression of GNRH1 protein CTD PMID:34896426 and PMID:37984602 Gnrh1 Mouse cypermethrin increases expression EXP 6480464 cypermethrin results in increased expression of GNRH1 mRNA CTD PMID:35931855 Gnrh1 Mouse cypermethrin affects expression EXP 6480464 cypermethrin affects the expression of GNRH1 mRNA CTD PMID:35931855 Gnrh1 Mouse DDE multiple interactions EXP 6480464 [Dichlorodiphenyl Dichloroethylene co-treated with beta-hexachlorocyclohexane] results in increased expression of GNRH1 mRNA CTD PMID:16758953 Gnrh1 Mouse DDE decreases expression ISO GNRH1 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of GNRH1 mRNA CTD PMID:38568856 Gnrh1 Mouse DDT multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [Hexachlorocyclohexane co-treated with DDT] results in increased expression of GNRH1 CTD PMID:16329587 Gnrh1 Mouse Dibutyl phosphate affects expression ISO GNRH1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of GNRH1 mRNA CTD PMID:37042841 Gnrh1 Mouse dibutyl phthalate affects expression EXP 6480464 Dibutyl Phthalate affects the expression of GNRH1 protein CTD PMID:34280466 Gnrh1 Mouse dibutyl phthalate increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of GNRH1 mRNA CTD PMID:33920546 Gnrh1 Mouse dieldrin affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 Dieldrin affects the expression of GNRH1 mRNA CTD PMID:22546817 Gnrh1 Mouse diethylstilbestrol affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Diethylstilbestrol affects the secretion of GNRH1 protein CTD PMID:24316331 and PMID:37077353 Gnrh1 Mouse dopamine multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Dopamine affects the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:18603625 Gnrh1 Mouse emamectin benzoate multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with emamectin benzoate] results in decreased expression of GNRH1 protein CTD PMID:37984602 Gnrh1 Mouse Estradiol 17beta-cyclopentylpropionate multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 estradiol 17 beta-cypionate affects the reaction [methylmercuric chloride affects the secretion of GNRH1 protein] CTD PMID:16406600 Gnrh1 Mouse fenvalerate multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of GNRH1 protein CTD PMID:34896426 Gnrh1 Mouse flavonoids decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Flavonoids results in decreased expression of GNRH1 mRNA CTD PMID:18035473 Gnrh1 Mouse flavonoids multiple interactions EXP 6480464 Flavonoids inhibits the reaction [Cyclophosphamide results in decreased secretion of GNRH1 protein] CTD PMID:39239657 Gnrh1 Mouse flutamide increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Flutamide results in increased expression of GNRH1 mRNA CTD PMID:24793618 Gnrh1 Mouse fulvestrant multiple interactions EXP 6480464 fulvestrant affects the reaction [2 more ... CTD PMID:10537130 more ... Gnrh1 Mouse fulvestrant decreases expression EXP 6480464 fulvestrant results in decreased expression of GNRH1 protein CTD PMID:19362103 Gnrh1 Mouse gamma-aminobutyric acid decreases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 gamma-Aminobutyric Acid results in decreased secretion of GNRH1 protein CTD PMID:17845906 Gnrh1 Mouse gamma-aminobutyric acid multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 gamma-Aminobutyric Acid inhibits the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:18603625 Gnrh1 Mouse gamma-hexachlorocyclohexane multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [Hexachlorocyclohexane co-treated with DDT] results in increased expression of GNRH1 CTD PMID:16329587 Gnrh1 Mouse genistein multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Genistein co-treated with Methoxychlor] results in increased expression of GNRH1 mRNA CTD PMID:21782745 Gnrh1 Mouse gentamycin increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of GNRH1 mRNA CTD PMID:33387578 Gnrh1 Mouse glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of GNRH1 mRNA CTD PMID:30245445 Gnrh1 Mouse haloperidol multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Haloperidol inhibits the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:18603625 Gnrh1 Mouse hydrogen peroxide affects expression ISO GNRH1 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of GNRH1 mRNA CTD PMID:20044591 Gnrh1 Mouse indole-3-methanol affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 indole-3-carbinol affects the expression of GNRH1 mRNA CTD PMID:21396975 Gnrh1 Mouse ketoconazole affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Ketoconazole affects the secretion of GNRH1 protein CTD PMID:37077353 Gnrh1 Mouse KT 5823 multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 KT 5823 inhibits the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:17110411 and PMID:17290048 Gnrh1 Mouse lipopolysaccharide increases expression ISO GNRH1 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of GNRH1 mRNA CTD PMID:35953652 Gnrh1 Mouse lipopolysaccharide multiple interactions ISO GNRH1 (Homo sapiens) 6480464 Lipopolysaccharides promotes the reaction [Propofol results in increased expression of GNRH1 mRNA] CTD PMID:35953652 Gnrh1 Mouse manganese atom increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Manganese results in increased expression of GNRH1 mRNA CTD PMID:23997110 Gnrh1 Mouse manganese(0) increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Manganese results in increased expression of GNRH1 mRNA CTD PMID:23997110 Gnrh1 Mouse manganese(II) chloride increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 manganese chloride results in increased expression of GNRH1 mRNA CTD PMID:21402727 Gnrh1 Mouse manganese(II) chloride increases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 manganese chloride results in increased secretion of GNRH1 protein CTD PMID:17110411 more ... Gnrh1 Mouse manganese(II) chloride multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 1H-(1 more ... CTD PMID:17110411 more ... Gnrh1 Mouse melatonin multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Melatonin promotes the reaction [bisphenol A results in increased expression of GNRH1 mRNA] CTD PMID:33967032 Gnrh1 Mouse melittin multiple interactions ISO GNRH1 (Homo sapiens) 6480464 GNRH1 protein results in increased susceptibility to [Melitten binds to CGB3 protein] CTD PMID:19261682 Gnrh1 Mouse mercury atom increases expression ISO GNRH1 (Homo sapiens) 6480464 Mercury results in increased expression of GNRH1 mRNA CTD PMID:16823088 Gnrh1 Mouse mercury(0) increases expression ISO GNRH1 (Homo sapiens) 6480464 Mercury results in increased expression of GNRH1 mRNA CTD PMID:16823088 Gnrh1 Mouse methoxychlor multiple interactions EXP 6480464 fulvestrant inhibits the reaction [Methoxychlor results in increased secretion of GNRH1 protein] CTD PMID:12088877 Gnrh1 Mouse methoxychlor increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Methoxychlor results in increased expression of GNRH1 mRNA and Methoxychlor results in increased expression of GNRH1 protein CTD PMID:21782745 and PMID:3097876 Gnrh1 Mouse methoxychlor multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Genistein co-treated with Methoxychlor] results in increased expression of GNRH1 mRNA and Methoxychlor promotes the reaction [Potassium Chloride results in increased abundance of GNRH1 protein] CTD PMID:21782745 and PMID:3097876 Gnrh1 Mouse methoxychlor increases secretion EXP 6480464 Methoxychlor results in increased secretion of GNRH1 protein CTD PMID:12088877 Gnrh1 Mouse methoxychlor affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 Methoxychlor affects the expression of GNRH1 mRNA CTD PMID:11394642 Gnrh1 Mouse methoxychlor decreases expression EXP 6480464 Methoxychlor metabolite results in decreased expression of GNRH1 mRNA CTD PMID:10537130 Gnrh1 Mouse methoxychlor affects expression EXP 6480464 Methoxychlor affects the expression of GNRH1 mRNA CTD PMID:12088877 Gnrh1 Mouse methylene blue multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Methylene Blue inhibits the reaction [manganese chloride results in increased secretion of GNRH1 protein] CTD PMID:17290048 Gnrh1 Mouse methylmercury chloride multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 estradiol 17 beta-cypionate affects the reaction [methylmercuric chloride affects the secretion of GNRH1 protein] CTD PMID:16406600 Gnrh1 Mouse methylmercury chloride affects secretion ISO Gnrh1 (Rattus norvegicus) 6480464 methylmercuric chloride affects the secretion of GNRH1 protein CTD PMID:16406600 Gnrh1 Mouse muscimol multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Muscimol affects the reaction [bisphenol A affects the secretion of GNRH1 protein] CTD PMID:26950200 Gnrh1 Mouse ochratoxin A increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 ochratoxin A results in increased expression of GNRH1 mRNA CTD PMID:22124623 Gnrh1 Mouse ochratoxin A increases expression ISO GNRH1 (Homo sapiens) 6480464 ochratoxin A metabolite results in increased expression of GNRH1 mRNA and ochratoxin A results in increased expression of GNRH1 mRNA CTD PMID:24356939 Gnrh1 Mouse paraquat increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Paraquat results in increased expression of GNRH1 mRNA CTD PMID:32680482 Gnrh1 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 Estrogens inhibits the reaction [perfluorooctane sulfonic acid results in decreased expression of GNRH1 protein] CTD PMID:26358002 Gnrh1 Mouse perfluorooctane-1-sulfonic acid decreases expression EXP 6480464 perfluorooctane sulfonic acid results in decreased expression of GNRH1 protein CTD PMID:26358002 Gnrh1 Mouse perfluorooctanoic acid multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of GNRH1 mRNA CTD PMID:35163327 Gnrh1 Mouse Phenoxybenzamine decreases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Phenoxybenzamine results in decreased secretion of GNRH1 protein CTD PMID:17845906 Gnrh1 Mouse phenylephrine multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 alfuzosin inhibits the reaction [Phenylephrine results in decreased secretion of GNRH1 protein] more ... CTD PMID:1975657 Gnrh1 Mouse phenylephrine increases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Phenylephrine results in increased secretion of GNRH1 protein CTD PMID:1975657 Gnrh1 Mouse phenylephrine decreases secretion ISO Gnrh1 (Rattus norvegicus) 6480464 Phenylephrine results in decreased secretion of GNRH1 protein CTD PMID:1975657 Gnrh1 Mouse potassium chloride increases abundance ISO Gnrh1 (Rattus norvegicus) 6480464 Potassium Chloride results in increased abundance of GNRH1 protein CTD PMID:3097876 Gnrh1 Mouse potassium chloride multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Methoxychlor promotes the reaction [Potassium Chloride results in increased abundance of GNRH1 protein] CTD PMID:3097876 Gnrh1 Mouse potassium chromate increases expression ISO GNRH1 (Homo sapiens) 6480464 potassium chromate(VI) results in increased expression of GNRH1 mRNA CTD PMID:22079256 Gnrh1 Mouse potassium chromate multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of GNRH1 mRNA CTD PMID:22079256 Gnrh1 Mouse potassium dichromate multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 [Potassium Dichromate results in increased abundance of chromium hexavalent ion] which results in decreased expression of GNRH1 protein CTD PMID:38532648 Gnrh1 Mouse procymidone decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 procymidone results in decreased expression of GNRH1 mRNA CTD PMID:15686871 Gnrh1 Mouse progesterone multiple interactions ISO GNRH1 (Homo sapiens) 6480464 [Progesterone co-treated with Estradiol] results in increased secretion of GNRH1 protein and Tamoxifen inhibits the reaction [[Progesterone co-treated with Estradiol] results in increased secretion of GNRH1 protein] CTD PMID:10566683 Gnrh1 Mouse progesterone decreases abundance ISO GNRH1 (Homo sapiens) 6480464 GNRH1 protein results in decreased abundance of Progesterone CTD PMID:19261682 Gnrh1 Mouse propofol increases expression ISO GNRH1 (Homo sapiens) 6480464 Propofol results in increased expression of GNRH1 mRNA CTD PMID:35953652 Gnrh1 Mouse propofol multiple interactions ISO GNRH1 (Homo sapiens) 6480464 Lipopolysaccharides promotes the reaction [Propofol results in increased expression of GNRH1 mRNA] CTD PMID:35953652 Gnrh1 Mouse pyrethrins increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Pyrethrins results in increased expression of GNRH1 protein CTD PMID:34896426 Gnrh1 Mouse raloxifene multiple interactions ISO GNRH1 (Homo sapiens) 6480464 Raloxifene Hydrochloride inhibits the reaction [Estradiol promotes the reaction [GNRH1 protein results in increased secretion of PRL protein]] CTD PMID:17054466 Gnrh1 Mouse sevoflurane increases expression ISO GNRH1 (Homo sapiens) 6480464 Sevoflurane results in increased expression of GNRH1 mRNA CTD PMID:35953652 Gnrh1 Mouse T-2 toxin decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 T-2 Toxin results in decreased expression of GNRH1 mRNA CTD PMID:26569305 Gnrh1 Mouse T-2 toxin increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 T-2 Toxin results in increased expression of GNRH1 mRNA CTD PMID:26847343 Gnrh1 Mouse tamoxifen multiple interactions ISO GNRH1 (Homo sapiens) 6480464 Tamoxifen inhibits the reaction [[Progesterone co-treated with Estradiol] results in increased secretion of GNRH1 protein] and Tamoxifen inhibits the reaction [GNRH1 protein results in increased secretion of LHB protein] CTD PMID:10566683 and PMID:3299987 Gnrh1 Mouse testosterone multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 Testosterone affects the reaction [Phenylephrine affects the secretion of GNRH1 protein] CTD PMID:1975657 Gnrh1 Mouse testosterone increases abundance ISO Gnrh1 (Rattus norvegicus) 6480464 GNRH1 protein results in increased abundance of Testosterone CTD PMID:2667955 Gnrh1 Mouse Tetrachlorobisphenol A decreases secretion EXP 6480464 tetrachlorodian results in decreased secretion of GNRH1 protein CTD PMID:37992829 Gnrh1 Mouse Tetrachlorobisphenol A affects expression ISO Gnrh1 (Rattus norvegicus) 6480464 tetrachlorodian affects the expression of GNRH1 mRNA CTD PMID:37992829 Gnrh1 Mouse Tetrachlorobisphenol A multiple interactions EXP 6480464 U 0126 inhibits the reaction [tetrachlorodian results in decreased expression of GNRH1 mRNA] and Wortmannin inhibits the reaction [tetrachlorodian results in decreased expression of GNRH1 mRNA] CTD PMID:37992829 Gnrh1 Mouse Tetrachlorobisphenol A decreases expression EXP 6480464 tetrachlorodian results in decreased expression of GNRH1 mRNA CTD PMID:37992829 Gnrh1 Mouse Tetrachlorobisphenol A increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 tetrachlorodian results in increased expression of GNRH1 protein CTD PMID:37992829 Gnrh1 Mouse tetrodotoxin decreases secretion EXP 6480464 Tetrodotoxin results in decreased secretion of GNRH1 protein CTD PMID:28731686 Gnrh1 Mouse thioacetamide increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of GNRH1 mRNA CTD PMID:34492290 Gnrh1 Mouse tributylstannane multiple interactions ISO Gnrh1 (Rattus norvegicus) 6480464 tributyltin inhibits the reaction [Estrogens deficiency results in increased expression of GNRH1 mRNA] and tributyltin inhibits the reaction [GNRH1 protein results in increased secretion of LHB protein] CTD PMID:28161095 Gnrh1 Mouse tributylstannane decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 tributyltin results in decreased expression of GNRH1 mRNA CTD PMID:28161095 Gnrh1 Mouse trichloroethene increases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of GNRH1 mRNA CTD PMID:33387578 Gnrh1 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of GNRH1 mRNA CTD PMID:33045310 Gnrh1 Mouse tris(2-butoxyethyl) phosphate affects expression ISO GNRH1 (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate affects the expression of GNRH1 mRNA CTD PMID:29024780 Gnrh1 Mouse valproic acid decreases expression ISO GNRH1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of GNRH1 mRNA CTD PMID:23179753 and PMID:24383497 Gnrh1 Mouse vinclozolin decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 vinclozolin results in decreased expression of GNRH1 mRNA CTD PMID:15686871 Gnrh1 Mouse wortmannin multiple interactions EXP 6480464 Wortmannin inhibits the reaction [tetrachlorodian results in decreased expression of GNRH1 mRNA] CTD PMID:37992829 Gnrh1 Mouse zearalenone decreases expression ISO Gnrh1 (Rattus norvegicus) 6480464 Zearalenone results in decreased expression of GNRH1 mRNA CTD PMID:29627501
Imported Annotations - KEGG (archival)
(-)-epigallocatechin 3-gallate (ISO) 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane (EXP) 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane (ISO) 1,2-dichloroethane (EXP) 17beta-estradiol (EXP,ISO) 17beta-estradiol 3-benzoate (ISO) 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',4,5-tetrachlorobiphenyl (EXP) 2,3',4,4',5-Pentachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3',5'-cyclic GMP (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) acetamide (ISO) acrylamide (ISO) alfuzosin (ISO) allethrin (ISO) alpha-Zearalanol (ISO) ammonium chloride (ISO) atrazine (ISO) benzo[a]pyrene (ISO) beta-hexachlorocyclohexane (EXP) bicuculline (ISO) bifenthrin (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol F (EXP,ISO) cadmium dichloride (EXP) calcium dichloride (ISO) carvone (ISO) chlormequat chloride (ISO) chlorpyrifos (EXP,ISO) chromium(6+) (ISO) cisplatin (ISO) clomiphene (ISO) cocaine (EXP) cyclophosphamide (EXP) cyhalothrin (ISO) cypermethrin (EXP,ISO) DDE (EXP,ISO) DDT (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) dieldrin (ISO) diethylstilbestrol (ISO) dopamine (ISO) emamectin benzoate (ISO) Estradiol 17beta-cyclopentylpropionate (ISO) fenvalerate (ISO) flavonoids (EXP,ISO) flutamide (ISO) fulvestrant (EXP) gamma-aminobutyric acid (ISO) gamma-hexachlorocyclohexane (ISO) genistein (ISO) gentamycin (ISO) glyphosate (EXP) haloperidol (ISO) hydrogen peroxide (ISO) indole-3-methanol (ISO) ketoconazole (ISO) KT 5823 (ISO) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) melatonin (ISO) melittin (ISO) mercury atom (ISO) mercury(0) (ISO) methoxychlor (EXP,ISO) methylene blue (ISO) methylmercury chloride (ISO) muscimol (ISO) ochratoxin A (ISO) paraquat (ISO) perfluorooctane-1-sulfonic acid (EXP) perfluorooctanoic acid (ISO) Phenoxybenzamine (ISO) phenylephrine (ISO) potassium chloride (ISO) potassium chromate (ISO) potassium dichromate (ISO) procymidone (ISO) progesterone (ISO) propofol (ISO) pyrethrins (ISO) raloxifene (ISO) sevoflurane (ISO) T-2 toxin (ISO) tamoxifen (ISO) testosterone (ISO) Tetrachlorobisphenol A (EXP,ISO) tetrodotoxin (EXP) thioacetamide (ISO) tributylstannane (ISO) trichloroethene (ISO) triptonide (EXP) tris(2-butoxyethyl) phosphate (ISO) valproic acid (ISO) vinclozolin (ISO) wortmannin (EXP) zearalenone (ISO)
1.
Isolated familial hypogonadotropic hypogonadism and a GNRH1 mutation.
Bouligand J, etal., N Engl J Med. 2009 Jun 25;360(26):2742-8. doi: 10.1056/NEJMoa0900136. Epub 2009 Jun 17.
2.
GNRH1 mutations in patients with idiopathic hypogonadotropic hypogonadism.
Chan YM, etal., Proc Natl Acad Sci U S A. 2009 Jul 14;106(28):11703-8. doi: 10.1073/pnas.0903449106. Epub 2009 Jun 30.
3.
R31C GNRH1 mutation and congenital hypogonadotropic hypogonadism.
Maione L, etal., PLoS One. 2013 Jul 25;8(7):e69616. doi: 10.1371/journal.pone.0069616. Print 2013.
4.
The hypogonadal mouse: reproductive functions restored by gene therapy.
Mason AJ, etal., Science. 1986 Dec 12;234(4782):1372-8.
5.
MGDs mouse GO annotations
MGD data from the GO Consortium
6.
MGD IEA
MGD IEA
7.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
8.
GnRH and LHR gene variants predict adverse outcome in premenopausal breast cancer patients.
Piersma D, etal., Breast Cancer Res. 2007;9(4):R51.
9.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
10.
Mouse MP Annotation Import Pipeline
RGD automated import pipeline
11.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
12.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
13.
Combining growth hormone-releasing hormone antagonist with luteinizing hormone-releasing hormone antagonist greatly augments benign prostatic hyperplasia shrinkage.
Rick FG, etal., J Urol. 2012 Apr;187(4):1498-504. doi: 10.1016/j.juro.2011.11.081. Epub 2012 Feb 17.
14.
Large-scale investigation of genomic markers for severe periodontitis.
Suzuki A, etal., Odontology. 2004 Sep;92(1):43-7.
Gnrh1 (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 67,982,717 - 67,986,889 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 67,982,630 - 67,986,888 (+) Ensembl GRCm39 Ensembl GRCm38 14 67,745,181 - 67,749,440 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 67,745,181 - 67,749,439 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 68,363,286 - 68,367,493 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 66,699,676 - 66,702,621 (+) NCBI MGSCv36 mm8 Celera 14 65,502,860 - 65,507,056 (+) NCBI Celera Cytogenetic Map 14 D1 NCBI cM Map 14 34.66 NCBI
GNRH1 (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 25,419,258 - 25,425,040 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 25,419,258 - 25,424,654 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 25,276,774 - 25,282,556 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 25,332,691 - 25,338,473 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 25,332,692 - 25,337,836 NCBI Celera 8 24,237,655 - 24,243,437 (-) NCBI Celera Cytogenetic Map 8 p21.2 NCBI HuRef 8 23,821,751 - 23,827,534 (-) NCBI HuRef CHM1_1 8 25,478,220 - 25,484,032 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 25,694,484 - 25,700,266 (-) NCBI T2T-CHM13v2.0
Gnrh1 (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 46,147,878 - 46,152,086 (+) NCBI GRCr8 mRatBN7.2 15 41,972,482 - 41,976,690 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 41,942,339 - 41,976,690 (+) Ensembl mRatBN7.2 Ensembl mRatBN7.2 Ensembl 15 41,972,905 - 41,973,581 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 43,837,145 - 43,841,353 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 44,987,366 - 44,991,574 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 43,432,699 - 43,436,907 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 44,441,856 - 44,446,064 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 44,441,856 - 44,446,064 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 44,442,555 - 44,442,875 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 47,151,131 - 47,155,339 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 47,303,309 - 47,307,517 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 47,319,088 - 47,323,286 (+) NCBI Celera 15 41,636,731 - 41,640,939 (+) NCBI Celera Cytogenetic Map 15 p12 NCBI
Gnrh1 (Chinchilla lanigera - long-tailed chinchilla)
Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955403 48,343,597 - 48,346,595 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955403 48,341,731 - 48,346,595 (-) NCBI ChiLan1.0 ChiLan1.0
GNRH1 (Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 43,960,415 - 43,967,332 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 19,674,806 - 19,680,584 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 24,700,268 - 24,707,332 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 21,609,407 - 21,616,521 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 21,609,407 - 21,615,936 (-) Ensembl panpan1.1 panPan2
GNRH1 (Canis lupus familiaris - dog)
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 25 32,038,631 - 32,043,192 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 25 32,039,613 - 32,043,028 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 25 32,623,319 - 32,627,816 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 25 32,237,978 - 32,242,489 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 25 32,238,905 - 32,242,478 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 25 32,193,651 - 32,198,162 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 25 32,043,144 - 32,047,652 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 25 32,208,954 - 32,213,456 (+) NCBI UU_Cfam_GSD_1.0
Gnrh1 (Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404943 10,029,435 - 10,033,174 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936757 1,282,185 - 1,285,832 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936757 1,282,185 - 1,285,804 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
GNRH1 (Sus scrofa - pig)
Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 9,442,971 - 9,453,035 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 9,442,971 - 9,447,521 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 10,597,132 - 10,607,824 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
GNRH1 (Chlorocebus sabaeus - green monkey)
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 23,543,717 - 23,550,728 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 23,542,806 - 23,547,771 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666052 18,616,776 - 18,623,795 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Gnrh1 (Heterocephalus glaber - naked mole-rat)
.
Predicted Target Of
Count of predictions: 88 Count of miRNA genes: 87 Interacting mature miRNAs: 88 Transcripts: ENSMUST00000111095 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1357589 Kdnw2_m kidney weight 2 (mouse) Not determined 14 20887473 121269804 Mouse 1300625 Cosz2_m cocaine seizure 2 (mouse) Not determined 14 35045797 68785736 Mouse 1301777 Bglq15_m body growth late QTL 15 (mouse) Not determined 14 42962416 76962593 Mouse 1301489 Lbm10_m lean body mass 10 (mouse) Not determined 14 53761296 87761529 Mouse 1357527 Epfpq1_m epididymal fat percentage QTL 1 (mouse) Not determined 14 21062450 71885801 Mouse 1301424 Skull21_m skull morphology 21 (mouse) Not determined 14 42962416 76962593 Mouse 4142364 Pbwg18_m postnatal body weight growth 18 (mouse) Not determined 14 52281984 86282125 Mouse 4141400 Nilac8_m nicotine induced locomotor activity 8 (mouse) Not determined 14 43065847 77066045 Mouse 10043889 Cia52_m collagen induced arthritis QTL 52 (mouse) Not determined 14 56082381 90082509 Mouse 27226774 Tibl15_m tibia length 15, 10 week (mouse) 14 30321957 87937436 Mouse 1301562 Hwq1_m heart weight quantitative locus 1 (mouse) Not determined 14 56546745 90546941 Mouse 1357565 wrmod1_m wobbler modifier 1 (mouse) Not determined 14 58179640 101859473 Mouse 1300666 Fembm2_m femoral bone morphometry 2 (mouse) Not determined 14 62397460 96397680 Mouse 10043888 Cia51_m collagen induced arthritis QTL 51 (mouse) Not determined 14 66103893 68785736 Mouse 4142419 Tgq26_m triglyceride QTL 26 (mouse) Not determined 40337319 74337319 Mouse 1300605 El5_m epilepsy 5 (mouse) Not determined 14 49455425 83455556 Mouse 11039527 Ccc2_m colitis susceptibility in the Collaborative Cross 2 (mouse) 14 59918612 94138217 Mouse 1301091 Bbaa21_m B.burgdorferi-associated arthritis 21 (mouse) Not determined 14 43065847 77066045 Mouse 12880432 Fgf23lq3_m FGF23 serum level QTL 3 (mouse) 14 53937440 87937440 Mouse 10043887 Cia50_m collagen induced arthritis QTL 50 (mouse) Not determined 14 37430185 71430320 Mouse 1300805 Mors3_m modifier of obesity related sterility 3 (mouse) Not determined 14 43037270 77037418 Mouse
D14Mit28
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 14 67,749,485 - 67,749,690 UniSTS GRCm38 MGSCv37 14 68,367,542 - 68,367,747 UniSTS GRCm37 Celera 14 65,507,105 - 65,507,296 UniSTS Cytogenetic Map 14 D1 UniSTS cM Map 14 28.4 UniSTS Whitehead Genetic 14 37.2 UniSTS Whitehead_YAC 14 UniSTS
Gnrh
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 14 D1 UniSTS cM Map 14 39.5 UniSTS
Gnrh
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 14 67,749,436 - 67,749,657 UniSTS GRCm38 MGSCv37 14 68,367,493 - 68,367,714 UniSTS GRCm37 Celera 14 65,507,056 - 65,507,263 UniSTS Cytogenetic Map 14 D1 UniSTS cM Map 14 39.5 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000111095 ⟹ ENSMUSP00000106724
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 14 67,982,717 - 67,986,888 (+) Ensembl GRCm38.p6 Ensembl 14 67,745,268 - 67,749,439 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000223929 ⟹ ENSMUSP00000153349
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 14 67,982,630 - 67,986,885 (+) Ensembl GRCm38.p6 Ensembl 14 67,745,181 - 67,749,436 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000223951 ⟹ ENSMUSP00000153071
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 14 67,983,719 - 67,986,802 (+) Ensembl GRCm38.p6 Ensembl 14 67,746,270 - 67,749,353 (+) Ensembl
RefSeq Acc Id:
NM_001416514 ⟹ NP_001403443
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 14 67,982,717 - 67,986,889 (+) NCBI
RefSeq Acc Id:
NM_008145 ⟹ NP_032171
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 14 67,982,717 - 67,986,889 (+) NCBI GRCm38 14 67,745,181 - 67,749,436 (+) NCBI MGSCv37 14 68,363,286 - 68,367,493 (+) RGD Celera 14 65,502,860 - 65,507,056 (+) RGD cM Map 14 ENTREZGENE
Sequence:
TGCAACTGTGCTCACCAGCGGGGAAGACATCAGTGTCCCAGAAAAAAAAAAATCATATAAAAAGGAAGCTAGGCAGACAGAAACTTCGAAGTACTCAACCTACCAACGGAAGCTCGAGATCCCTTTGA CTTTCACATCCAAACAGAGTGGACATGATCCTCAAACTGATGGCCGGCATTCTACTGCTGACTGTGTGTTTGGAAGGCTGCTCCAGCCAGCACTGGTCCTATGGGTTGCGCCCTGGGGGAAAGAGAAA CACTGAACACTTGGTTGAGTCTTTCCAAGAGATGGGCAAGGAGGTGGATCAAATGGCAGAACCCCAGCACTTCGAATGTACTGTCCACTGGCCCCGTTCACCCCTCAGGGATCTGCGAGGAGCTCTGG AAAGTCTGATTGAAGAGGAAGCCAGGCAGAAGAAGATGTAGATGCACTGGCCCAGGTGGATCCACAACACCCGAGTATAACATTGACCCTGAGGCTTGTGACCTGTTAATGGCTCTGTAATTGTGTAA GCTTGAGCGTTTTTATACCCAGCAGCGTAGATTTCATAATAAAGTAGTTTGTTGTGGAAAAAAAAAAA
hide sequence
RefSeq Acc Id:
NP_032171 ⟸ NM_008145
- Peptide Label:
isoform 1 preproprotein
- UniProtKB:
P13562 (UniProtKB/Swiss-Prot), Q3UTE9 (UniProtKB/TrEMBL), Q14AC4 (UniProtKB/TrEMBL)
- Sequence:
MILKLMAGILLLTVCLEGCSSQHWSYGLRPGGKRNTEHLVESFQEMGKEVDQMAEPQHFECTVHWPRSPLRDLRGALESLIEEEARQKKM
hide sequence
Ensembl Acc Id:
ENSMUSP00000106724 ⟸ ENSMUST00000111095
Ensembl Acc Id:
ENSMUSP00000153349 ⟸ ENSMUST00000223929
Ensembl Acc Id:
ENSMUSP00000153071 ⟸ ENSMUST00000223951
RefSeq Acc Id:
NP_001403443 ⟸ NM_001416514
- Peptide Label:
isoform 2
- UniProtKB:
A0A286YDB0 (UniProtKB/TrEMBL)
RGD ID: 8682826
Promoter ID: EPDNEW_M19444
Type: single initiation site
Name: Gnrh1_1
Description: Mus musculus gonadotropin releasing hormone 1 , transcript variant1, mRNA.
SO ACC ID: SO:0000170
Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ )
Experiment Methods: Single-end sequencing.
Position: Mouse Assembly Chr Position (strand) Source GRCm38 14 67,745,268 - 67,745,328 EPDNEW
RGD ID: 6825045
Promoter ID: MM_KWN:17315
Type: Non-CpG
SO ACC ID: SO:0000170
Source: MPROMDB
Tissues & Cell Lines: 3T3L1_Day2, BoneMarrow_0Hour, MEF_B6
Transcripts: NM_008145
Position: Mouse Assembly Chr Position (strand) Source MGSCv36 14 68,362,606 - 68,363,106 (+) MPROMDB
RGD ID: 6825044
Promoter ID: MM_KWN:17316
Type: Non-CpG
SO ACC ID: SO:0000170
Source: MPROMDB
Tissues & Cell Lines: 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, BoneMarrow_0Hour, Kidney, MEF_B4, MEF_B6
Transcripts: ENSMUST00000111095
Position: Mouse Assembly Chr Position (strand) Source MGSCv36 14 68,363,436 - 68,364,802 (+) MPROMDB