Symbol:
Pou4f2
Name:
POU domain, class 4, transcription factor 2
RGD ID:
1552160
MGI Page
MGI
Description:
Enables several functions, including DNA-binding transcription factor activity, RNA polymerase II-specific; p53 binding activity; and promoter-specific chromatin binding activity. Involved in several processes, including cellular response to estradiol stimulus; regulation of DNA-templated transcription; and regulation of neuron projection development. Acts upstream of or within several processes, including axonogenesis; neuromuscular process controlling balance; and sensory perception of sound. Located in cytoplasm; euchromatin; and nucleus. Is expressed in several structures, including central nervous system; glomerular tuft; placenta; somite; and visual system. Orthologous to human POU4F2 (POU class 4 homeobox 2).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
brain-3B; brain-specific homeobox/POU domain protein 3B; Brn; Brn-; Brn-3; Brn-3.2; Brn-3b; Brn3b; mBrn3; mBrn3-3R; POU domain, class 4, transcription factor, related sequence 1; Pou4f; Pou4f-rs1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
POU4F2 (POU class 4 homeobox 2) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Pou4f2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pou4f2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
POU4F2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
POU4F2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pou4f2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
POU4F2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
POU4F2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pou4f2 (POU class 4 homeobox 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Pou4f2 (POU class 4 homeobox 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
POU4F2 (POU class 4 homeobox 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pou4f2 (POU class 4 homeobox 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Caenorhabditis elegans (roundworm):
unc-86
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
acj6
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
pou4f2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 79,159,638 - 79,163,276 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 79,159,639 - 79,163,274 (-) Ensembl GRCm39 Ensembl GRCm38 8 78,433,009 - 78,436,647 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 78,433,010 - 78,436,645 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 80,956,908 - 80,960,551 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 81,329,081 - 81,332,724 (-) NCBI MGSCv36 mm8 Celera 8 82,709,269 - 82,712,912 (-) NCBI Celera Cytogenetic Map 8 C1 NCBI cM Map 8 36.99 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pou4f2 Mouse 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine decreases expression EXP 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:29627306 Pou4f2 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of POU4F2 mRNA CTD PMID:24058054 Pou4f2 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Pou4f2 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of POU4F2 mRNA CTD PMID:32109520 Pou4f2 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of POU4F2 mRNA CTD PMID:21570461 Pou4f2 Mouse aflatoxin B1 decreases methylation ISO POU4F2 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of POU4F2 gene CTD PMID:27153756 Pou4f2 Mouse all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of POU4F2 mRNA CTD PMID:16604517 Pou4f2 Mouse ammonium chloride affects expression ISO Pou4f2 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of POU4F2 mRNA CTD PMID:16483693 Pou4f2 Mouse antimycin A decreases expression ISO POU4F2 (Homo sapiens) 6480464 Antimycin A results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse arsenite(3-) increases methylation ISO POU4F2 (Homo sapiens) 6480464 arsenite results in increased methylation of POU4F2 promoter CTD PMID:23974009 Pou4f2 Mouse benzo[a]pyrene multiple interactions EXP 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to POU4F2 promoter] CTD PMID:19654925 Pou4f2 Mouse benzo[a]pyrene affects methylation ISO POU4F2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of POU4F2 promoter CTD PMID:27901495 Pou4f2 Mouse benzo[a]pyrene increases methylation ISO POU4F2 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of POU4F2 exon CTD PMID:27901495 Pou4f2 Mouse benzo[a]pyrene affects expression ISO POU4F2 (Homo sapiens) 6480464 Benzo(a)pyrene affects the expression of POU4F2 mRNA CTD PMID:22316170 Pou4f2 Mouse bisphenol A decreases expression ISO Pou4f2 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of POU4F2 mRNA CTD PMID:25181051 Pou4f2 Mouse bisphenol A affects methylation EXP 6480464 bisphenol A affects the methylation of POU4F2 promoter CTD PMID:27334623 Pou4f2 Mouse cadmium dichloride multiple interactions ISO Pou4f2 (Rattus norvegicus) 6480464 [sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in decreased expression of POU4F2 protein CTD PMID:23680456 Pou4f2 Mouse CGP 52608 multiple interactions ISO POU4F2 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to POU4F2 gene] CTD PMID:28238834 Pou4f2 Mouse choline multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of POU4F2 gene CTD PMID:20938992 Pou4f2 Mouse copper atom increases expression ISO Pou4f2 (Rattus norvegicus) 6480464 Copper deficiency results in increased expression of POU4F2 mRNA CTD PMID:26033743 Pou4f2 Mouse copper(0) increases expression ISO Pou4f2 (Rattus norvegicus) 6480464 Copper deficiency results in increased expression of POU4F2 mRNA CTD PMID:26033743 Pou4f2 Mouse daidzein multiple interactions ISO POU4F2 (Homo sapiens) 6480464 [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of POU4F2 mRNA CTD PMID:16963248 Pou4f2 Mouse deguelin decreases expression ISO POU4F2 (Homo sapiens) 6480464 deguelin results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse diazinon increases methylation ISO POU4F2 (Homo sapiens) 6480464 Diazinon results in increased methylation of POU4F2 gene CTD PMID:22964155 Pou4f2 Mouse entinostat decreases expression ISO POU4F2 (Homo sapiens) 6480464 entinostat results in decreased expression of POU4F2 mRNA CTD PMID:27188386 Pou4f2 Mouse folic acid multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of POU4F2 gene CTD PMID:20938992 Pou4f2 Mouse fonofos increases methylation ISO POU4F2 (Homo sapiens) 6480464 Fonofos results in increased methylation of POU4F2 promoter CTD PMID:22847954 Pou4f2 Mouse genistein multiple interactions ISO POU4F2 (Homo sapiens) 6480464 [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of POU4F2 mRNA CTD PMID:16963248 Pou4f2 Mouse glycitein multiple interactions ISO POU4F2 (Homo sapiens) 6480464 [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of POU4F2 mRNA CTD PMID:16963248 Pou4f2 Mouse L-methionine multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of POU4F2 gene CTD PMID:20938992 Pou4f2 Mouse lead diacetate increases expression EXP 6480464 lead acetate results in increased expression of POU4F2 mRNA CTD PMID:20542052 Pou4f2 Mouse lead diacetate multiple interactions ISO Pou4f2 (Rattus norvegicus) 6480464 [sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in decreased expression of POU4F2 protein CTD PMID:23680456 Pou4f2 Mouse lead(0) affects expression ISO POU4F2 (Homo sapiens) 6480464 Lead affects the expression of POU4F2 mRNA CTD PMID:28903495 Pou4f2 Mouse lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of POU4F2 mRNA CTD PMID:10975854 Pou4f2 Mouse lipopolysaccharide multiple interactions ISO POU4F2 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of POU4F2 mRNA CTD PMID:35811015 Pou4f2 Mouse methoxychlor increases methylation ISO Pou4f2 (Rattus norvegicus) 6480464 Methoxychlor results in increased methylation of POU4F2 gene CTD PMID:19589859 Pou4f2 Mouse methylmercury chloride affects expression EXP 6480464 methylmercuric chloride affects the expression of POU4F2 mRNA CTD PMID:21613230 Pou4f2 Mouse N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine increases expression ISO POU4F2 (Homo sapiens) 6480464 N more ... CTD PMID:12756304 Pou4f2 Mouse parathion increases methylation ISO POU4F2 (Homo sapiens) 6480464 Parathion results in increased methylation of POU4F2 promoter CTD PMID:22847954 Pou4f2 Mouse picoxystrobin decreases expression ISO POU4F2 (Homo sapiens) 6480464 picoxystrobin results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse pirinixic acid multiple interactions EXP 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of POU4F2 mRNA CTD PMID:19710929 Pou4f2 Mouse pyrimidifen decreases expression ISO POU4F2 (Homo sapiens) 6480464 pyrimidifen results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse rotenone decreases expression ISO POU4F2 (Homo sapiens) 6480464 Rotenone results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO POU4F2 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of POU4F2 mRNA CTD PMID:35811015 Pou4f2 Mouse sodium arsenite increases expression ISO POU4F2 (Homo sapiens) 6480464 sodium arsenite results in increased expression of POU4F2 mRNA CTD PMID:25879800 Pou4f2 Mouse sodium arsenite multiple interactions ISO Pou4f2 (Rattus norvegicus) 6480464 [sodium arsenite co-treated with lead acetate co-treated with Cadmium Chloride] results in decreased expression of POU4F2 protein CTD PMID:23680456 Pou4f2 Mouse tebufenpyrad decreases expression ISO POU4F2 (Homo sapiens) 6480464 4-chloro-N-((4-(1 and 1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse terbufos increases methylation ISO POU4F2 (Homo sapiens) 6480464 terbufos results in increased methylation of POU4F2 promoter CTD PMID:22847954 Pou4f2 Mouse thifluzamide decreases expression ISO POU4F2 (Homo sapiens) 6480464 thifluzamide results in decreased expression of POU4F2 mRNA CTD PMID:33512557 Pou4f2 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of POU4F2 gene CTD PMID:35295148 Pou4f2 Mouse trichloroethene decreases expression ISO Pou4f2 (Rattus norvegicus) 6480464 Trichloroethylene results in decreased expression of POU4F2 mRNA CTD PMID:33387578 Pou4f2 Mouse valproic acid increases expression ISO POU4F2 (Homo sapiens) 6480464 Valproic Acid results in increased expression of POU4F2 mRNA CTD PMID:23179753 and PMID:24383497 Pou4f2 Mouse valproic acid decreases methylation ISO POU4F2 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of POU4F2 gene CTD PMID:29154799 Pou4f2 Mouse valproic acid affects expression ISO POU4F2 (Homo sapiens) 6480464 Valproic Acid affects the expression of POU4F2 mRNA CTD PMID:25979313 Pou4f2 Mouse vorinostat decreases expression ISO POU4F2 (Homo sapiens) 6480464 vorinostat results in decreased expression of POU4F2 mRNA CTD PMID:27188386 Pou4f2 Mouse zinc sulfate decreases expression ISO POU4F2 (Homo sapiens) 6480464 Zinc Sulfate results in decreased expression of POU4F2 mRNA CTD PMID:12756304
1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP) ammonium chloride (ISO) antimycin A (ISO) arsenite(3-) (ISO) benzo[a]pyrene (EXP,ISO) bisphenol A (EXP,ISO) cadmium dichloride (ISO) CGP 52608 (ISO) choline (EXP) copper atom (ISO) copper(0) (ISO) daidzein (ISO) deguelin (ISO) diazinon (ISO) entinostat (ISO) folic acid (EXP) fonofos (ISO) genistein (ISO) glycitein (ISO) L-methionine (EXP) lead diacetate (EXP,ISO) lead(0) (ISO) lipopolysaccharide (EXP,ISO) methoxychlor (ISO) methylmercury chloride (EXP) N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (ISO) parathion (ISO) picoxystrobin (ISO) pirinixic acid (EXP) pyrimidifen (ISO) rotenone (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) sodium arsenite (ISO) tebufenpyrad (ISO) terbufos (ISO) thifluzamide (ISO) titanium dioxide (EXP) trichloroethene (ISO) valproic acid (ISO) vorinostat (ISO) zinc sulfate (ISO)
Biological Process
apoptotic process (IEA) axon extension (IGI) axon guidance (IMP) axonogenesis (IMP) cellular response to cytokine stimulus (IDA) cellular response to estradiol stimulus (IDA) cellular response to insulin stimulus (IMP) cellular response to oxygen levels (IEA,ISO) dorsal root ganglion development (IMP) estrogen receptor signaling pathway (ISO,ISS) heart development (IGI) intrinsic apoptotic signaling pathway by p53 class mediator (IMP) MAPK cascade (ISO,ISS) negative regulation of adipose tissue development (IMP) negative regulation of amacrine cell differentiation (IMP) negative regulation of cell differentiation (IMP) negative regulation of DNA-binding transcription factor activity (IDA) negative regulation of transcription by RNA polymerase II (IDA,IMP,ISO) neuromuscular process controlling balance (IGI) neuron differentiation (IGI,IMP) positive regulation of axon extension (IMP) positive regulation of cardiac muscle cell apoptotic process (IEA,ISO) positive regulation of cell differentiation (IMP) positive regulation of D-glucose import (IMP) positive regulation of osteoclast differentiation (IMP) positive regulation of programmed cell death (IMP) positive regulation of transcription by RNA polymerase II (IDA,IEA,IGI,IMP,ISO) regulation of DNA-binding transcription factor activity (IDA) regulation of gene expression (ISO) regulation of retinal ganglion cell axon guidance (IMP) regulation of transcription by RNA polymerase II (IBA) retina development in camera-type eye (IMP) retinal ganglion cell axon guidance (IGI,IMP) sensory perception of sound (IGI) spermatogenesis (IEA,ISO)
Molecular Function
chromatin binding (IDA) DNA-binding transcription activator activity, RNA polymerase II-specific (IDA,IMP,ISO) DNA-binding transcription factor activity (ISS,TAS) DNA-binding transcription factor activity, RNA polymerase II-specific (IBA,IMP,ISO) DNA-binding transcription repressor activity, RNA polymerase II-specific (IDA) p53 binding (IPI) promoter-specific chromatin binding (IDA) protein binding (IPI) RNA polymerase II cis-regulatory region sequence-specific DNA binding (IBA,IEA,ISO) RNA polymerase II transcription regulatory region sequence-specific DNA binding (IDA) sequence-specific DNA binding (IDA,IMP)
Pou4f2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 79,159,638 - 79,163,276 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 79,159,639 - 79,163,274 (-) Ensembl GRCm39 Ensembl GRCm38 8 78,433,009 - 78,436,647 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 78,433,010 - 78,436,645 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 80,956,908 - 80,960,551 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 81,329,081 - 81,332,724 (-) NCBI MGSCv36 mm8 Celera 8 82,709,269 - 82,712,912 (-) NCBI Celera Cytogenetic Map 8 C1 NCBI cM Map 8 36.99 NCBI
POU4F2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 4 146,638,893 - 146,642,474 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 4 146,638,893 - 146,642,474 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 4 147,560,045 - 147,563,626 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 4 147,779,495 - 147,783,073 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 4 147,917,692 - 147,921,228 NCBI Celera 4 144,880,585 - 144,884,163 (+) NCBI Celera Cytogenetic Map 4 q31.22 NCBI HuRef 4 143,287,267 - 143,290,856 (+) NCBI HuRef CHM1_1 4 147,537,342 - 147,540,923 (+) NCBI CHM1_1 T2T-CHM13v2.0 4 149,962,609 - 149,966,195 (+) NCBI T2T-CHM13v2.0
Pou4f2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 46,390,958 - 46,394,599 (+) NCBI GRCr8 mRatBN7.2 19 29,486,686 - 29,490,327 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 29,486,686 - 29,490,327 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 36,334,714 - 36,338,345 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 36,988,601 - 36,992,232 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 39,237,705 - 39,241,336 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 33,160,180 - 33,163,821 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 33,160,180 - 33,163,821 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 44,051,763 - 44,055,404 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 31,388,907 - 31,392,548 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 19 31,395,364 - 31,395,583 (+) NCBI Celera 19 28,985,198 - 28,988,839 (+) NCBI Celera Cytogenetic Map 19 q11 NCBI
Pou4f2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955428 2,324,834 - 2,329,205 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955428 2,325,775 - 2,329,122 (+) NCBI ChiLan1.0 ChiLan1.0
POU4F2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 3 144,502,661 - 144,505,603 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 4 144,868,893 - 144,871,835 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 4 138,969,157 - 138,972,730 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 4 150,626,392 - 150,629,961 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 4 150,626,392 - 150,629,961 (+) Ensembl panpan1.1 panPan2
POU4F2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 15 45,030,818 - 45,034,446 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 15 45,031,094 - 45,032,784 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 15 45,426,310 - 45,427,991 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 15 45,704,140 - 45,705,824 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 15 45,704,140 - 45,705,824 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 15 44,976,012 - 44,977,696 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 15 45,068,621 - 45,070,311 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 15 45,333,613 - 45,335,300 (+) NCBI UU_Cfam_GSD_1.0
Pou4f2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405301 45,265,697 - 45,274,468 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936535 2,705,162 - 2,711,813 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936535 2,705,184 - 2,711,785 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
POU4F2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 8 82,043,643 - 82,047,675 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 8 82,044,443 - 82,046,377 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 8 87,200,440 - 87,201,609 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
POU4F2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 7 93,150,105 - 93,160,977 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 7 93,150,186 - 93,151,857 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 72,832,429 - 72,836,291 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pou4f2
.
Predicted Target Of
Count of predictions: 821 Count of miRNA genes: 415 Interacting mature miRNAs: 574 Transcripts: ENSMUST00000034115 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
10043992 Hbnr11_m Heligmosomoides bakeri nematode resistance 11 (mouse) Not determined 8 66326836 100326976 Mouse 1301013 Capsq4_m capsaicin sensitivity related QTL 4 (mouse) Not determined 8 36630154 93455280 Mouse 1301717 Adip4_m adiposity 4 (mouse) Not determined 8 48090064 82090180 Mouse 1357715 Alaa3_m alopecia areata 3 (mouse) Not determined 8 49245591 83245673 Mouse 11353828 Gf7_m gonadal fat pad weight 7 (mouse) 8 58928107 92928107 Mouse 14746987 Manh64_m mandible shape 64 (mouse) 8 50505958 84505958 Mouse 1357470 Obq16_m obesity QTL 16 (mouse) Not determined 8 76411976 110412125 Mouse 1558875 Eae31_m experimental allergic encephalomyelitis susceptibility 31 (mouse) Not determined 8 35109930 115563747 Mouse 1357787 Vtbt5_m vertebral trabecular bone trait 5 (mouse) Not determined 8 66084397 100084549 Mouse 10766453 Char11_m P. chabaudi malaria resistance QTL 11 (mouse) 8 48090064 82090180 Mouse 1301506 Aevm1_m autoimmune extremity vasculitis in MRL mice 1 (mouse) Not determined 8 54740461 88740637 Mouse 1301441 Skull11_m skull morphology 11 (mouse) Not determined 8 48190168 82190288 Mouse 1301952 Im3_m immunoregulatory 3 (mouse) Not determined 8 55159258 89159407 Mouse 1301767 Fcsa2_m femoral cross-sectional area 2 (mouse) Not determined 8 71032003 105032123 Mouse 10412234 Nhdlq14_m non-HDL QTL 14 (mouse) Not determined 8 76411976 110412125 Mouse 4140967 Bmd39_m bone mineral density 39 (mouse) Not determined 8 32506572 117965439 Mouse 1357708 Orq1_m ovulation rate QTL 1 (mouse) Not determined 8 71740461 124622354 Mouse 4141285 Tgq18_m triglyceride QTL 18 (mouse) Not determined 64186736 98186736 Mouse 4141797 Skmw16_m skeletal muscle weight 16 (mouse) Not determined 8 64666176 98666325 Mouse 14747005 Mancz7_m mandible centroid size 7 (mouse) 8 50505958 84505958 Mouse 27226754 Femd6_m femur midshaft diameter 6, 10 week (mouse) 8 37867154 110326632 Mouse 10043975 Obq31_m obesity QTL 31 (mouse) Not determined 8 59136404 93136404 Mouse 10412287 Carg3_m Candida albicans resistance gene 3 (mouse) Not determined 8 56298872 90298872 Mouse 1301874 Hdlq16_m HDL QTL 16 (mouse) Not determined 8 76411976 110412125 Mouse 1301872 Cd4ts3_m CD4 T cell subset 3 (mouse) Not determined 8 72122809 106123021 Mouse 10766466 Char12_m P. chabaudi malaria resistance QTL 12 (mouse) 8 68722479 83326976 Mouse 1301688 Orch6_m autoimmune orchitis resistance 6 (mouse) Not determined 8 61513479 95513605 Mouse 1558780 Idd22_m insulin dependent diabetes susceptibility 22 (mouse) Not determined 8 71829531 105829637 Mouse 1300920 Pitm3_m prion incubation time 3 (mouse) Not determined 8 73929123 107929226 Mouse 12904744 Carcdq1_m cardiac collagen deposition QTL 1 (mouse) 8 40162297 95416226 Mouse 4141395 Char2a_m P. chabaudi malaria resistance QTL 2a (mouse) Not determined 71589427 90929226 Mouse 14700686 Civq3_m cerebral infarct volume QTL 3 (mouse) 8 52334843 86334843 Mouse 4142283 Imraq2_m immune response to AAV2 QTL 2 (mouse) Not determined 8 71032003 105032123 Mouse 27095912 Pglq14_m pelvic girdle length QTL 14, 16 week (mouse) 8 74126628 126826739 Mouse 4142023 W3q5_m weight 3 weeks QTL 5 (mouse) Not determined 71740461 124622354 Mouse 1558890 Lith18_m lithogenic gene 18 (mouse) Not determined 8 76402145 110402251 Mouse
PMC125354P2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 8 78,435,378 - 78,435,677 UniSTS GRCm38 MGSCv37 8 80,959,277 - 80,959,576 UniSTS GRCm37 Celera 8 82,711,638 - 82,711,937 UniSTS
Pou4f2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 8 78,435,527 - 78,435,617 UniSTS GRCm38 MGSCv37 8 80,958,947 - 80,959,612 UniSTS GRCm37 MGSCv37 8 80,959,176 - 80,959,294 UniSTS GRCm37 Celera 8 82,711,787 - 82,711,877 UniSTS cM Map X UniSTS cM Map X UniSTS cM Map X UniSTS cM Map 8 UniSTS
PMC97568P2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 8 78,434,553 - 78,434,890 UniSTS GRCm38 MGSCv37 8 80,958,452 - 80,958,789 UniSTS GRCm37 Celera 8 82,710,813 - 82,711,150 UniSTS
Pou4f2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 8 78,435,048 - 78,435,713 UniSTS GRCm38 MGSCv37 8 80,958,947 - 80,959,612 UniSTS GRCm37 Celera 8 82,711,308 - 82,711,973 UniSTS
Pou4f2
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 8 78,435,277 - 78,435,395 UniSTS GRCm38 MGSCv37 8 80,959,176 - 80,959,294 UniSTS GRCm37 Celera 8 82,711,537 - 82,711,655 UniSTS cM Map X UniSTS
Pou4f2
Mouse Assembly Chr Position (strand) Source JBrowse cM Map X UniSTS
Pou4f2
Mouse Assembly Chr Position (strand) Source JBrowse cM Map 8 UniSTS cM Map X UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000034115 ⟹ ENSMUSP00000034115
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 8 79,159,639 - 79,163,274 (-) Ensembl GRCm38.p6 Ensembl 8 78,433,010 - 78,436,645 (-) Ensembl
RefSeq Acc Id:
NM_138944 ⟹ NP_620394
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 8 79,159,638 - 79,163,276 (-) NCBI GRCm38 8 78,433,009 - 78,436,647 (-) NCBI MGSCv37 8 80,956,908 - 80,960,551 (-) RGD Celera 8 82,709,269 - 82,712,912 (-) RGD cM Map 8 ENTREZGENE
Sequence:
ACTTTGGGGTGCTGAGGTCTGAAGCCAGAGCCACCCGGAGCAGGGCAACCTCTCGGGCAGACCTAGCGGGAGACACAGGAGCGGAGCTAGCGGCCACACTGGGAGAACCGGGCCTGGAAGCAGTGGCG
hide sequence
RefSeq Acc Id:
NP_620394 ⟸ NM_138944
- UniProtKB:
Q63954 (UniProtKB/Swiss-Prot), Q63934 (UniProtKB/Swiss-Prot)
- Sequence:
MMMMSLNSKQAFSMPHAGSLHVEPKYSALHSASPGSSAPAAPSASSPSSSSNAGGGGGGGGGGGGGGRSSSSSSSGSGGSGGGGGSEAMRRACLPTPPSNIFGGLDESLLARAEALAAVDIVSQSKSH
hide sequence
Ensembl Acc Id:
ENSMUSP00000034115 ⟸ ENSMUST00000034115
RGD ID: 8667537 Promoter ID: EPDNEW_M11797 Type: single initiation site Name: Pou4f2_1 Description: Mus musculus POU domain, class 4, transcription factor 2 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 8 78,436,647 - 78,436,707 EPDNEW
