Symbol:
URB1
Name:
URB1 ribosome biogenesis homolog
RGD ID:
1353651
HGNC Page
HGNC:17344
Description:
Enables RNA binding activity. Predicted to be involved in maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) and maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA). Located in fibrillar center.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
C21orf108; KIAA0539; NPA1; nucleolar pre-ribosomal-associated protein 1; nucleolar preribosomal-associated protein 1; nucleolar protein 254 kDa; URB1 ribosome biogenesis 1 homolog; URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Mus musculus (house mouse):
Urb1 (URB1 ribosome biogenesis 1 homolog (S. cerevisiae)) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, Treefam
Rattus norvegicus (Norway rat):
Urb1 (URB1 ribosome biogenesis homolog) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Chinchilla lanigera (long-tailed chinchilla):
Urb1 (URB1 ribosome biogenesis homolog) NCBI
Ortholog
Pan paniscus (bonobo/pygmy chimpanzee):
URB1 (URB1 ribosome biogenesis homolog) NCBI
Ortholog
Canis lupus familiaris (dog):
URB1 (URB1 ribosome biogenesis homolog) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Urb1 (URB1 ribosome biogenesis homolog) NCBI
Ortholog
Sus scrofa (pig):
URB1 (URB1 ribosome biogenesis homolog) HGNC
Ensembl, NCBI, OrthoDB
Chlorocebus sabaeus (green monkey):
URB1 (URB1 ribosome biogenesis homolog) NCBI
Ortholog
Heterocephalus glaber (naked mole-rat):
Urb1 (URB1 ribosome biogenesis homolog) NCBI
Ortholog
Other homologs 2
Rattus norvegicus (Norway rat):
Fmnl1 (formin-like 1) HGNC
OMA
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Urb1 (URB1 ribosome biogenesis homolog)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Urb1 (URB1 ribosome biogenesis 1 homolog (S. cerevisiae))
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
urb1 (URB1 ribosome biogenesis homolog)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Drosophila melanogaster (fruit fly):
CG12499
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER)
Caenorhabditis elegans (roundworm):
T05H4.10
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PhylomeDB)
Saccharomyces cerevisiae (baker's yeast):
URB1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER)
Xenopus laevis (African clawed frog):
urb1.L
Alliance
DIOPT (Xenbase)
Xenopus tropicalis (tropical clawed frog):
urb1
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Allele / Splice:
See ClinVar data
Latest Assembly:
GRCh38 - Human Genome Assembly GRCh38
Position:
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 21 32,311,018 - 32,393,012 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 21 32,311,018 - 32,393,012 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 21 33,683,329 - 33,765,321 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 21 33,683,330 - 33,765,312 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 21 18,866,931 - 18,948,939 (-) NCBI Celera Cytogenetic Map 21 q22.11 NCBI HuRef 21 19,092,100 - 19,174,182 (-) NCBI HuRef CHM1_1 21 33,245,146 - 33,327,161 (-) NCBI CHM1_1 T2T-CHM13v2.0 21 30,680,775 - 30,762,860 (-) NCBI T2T-CHM13v2.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
URB1 Human (+)-schisandrin B multiple interactions ISO Urb1 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of URB1 mRNA] CTD PMID:31150632 URB1 Human 1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene multiple interactions ISO Urb1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 URB1 Human 1,2-dichloroethane decreases expression ISO Urb1 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of URB1 mRNA CTD PMID:28960355 URB1 Human 1-chloro-2,4-dinitrobenzene affects binding EXP 6480464 Dinitrochlorobenzene binds to URB1 protein CTD PMID:32991956 URB1 Human 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of URB1 mRNA CTD PMID:23019147 and PMID:31614463 URB1 Human 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Urb1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 URB1 Human 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Urb1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 URB1 Human 2,4,4'-trichlorobiphenyl multiple interactions ISO Urb1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 URB1 Human 3-isobutyl-1-methyl-7H-xanthine multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of URB1 mRNA more ... CTD PMID:28628672 URB1 Human 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of URB1 mRNA CTD PMID:28628672 URB1 Human 4,4'-sulfonyldiphenol increases methylation EXP 6480464 bisphenol S results in increased methylation of URB1 gene CTD PMID:31601247 URB1 Human aflatoxin B1 increases methylation EXP 6480464 Aflatoxin B1 results in increased methylation of URB1 gene CTD PMID:27153756 URB1 Human aflatoxin B1 decreases methylation EXP 6480464 Aflatoxin B1 results in decreased methylation of URB1 exon CTD PMID:30157460 URB1 Human all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of URB1 mRNA CTD PMID:33167477 URB1 Human amphetamine decreases expression ISO Urb1 (Rattus norvegicus) 6480464 Amphetamine results in decreased expression of URB1 mRNA CTD PMID:30779732 URB1 Human aristolochic acid A increases expression EXP 6480464 aristolochic acid I results in increased expression of URB1 mRNA CTD PMID:33212167 URB1 Human arsenite(3-) decreases expression ISO Urb1 (Mus musculus) 6480464 arsenite results in decreased expression of URB1 protein CTD PMID:37955338 URB1 Human benzo[a]pyrene increases methylation EXP 6480464 Benzo(a)pyrene results in increased methylation of URB1 3' UTR CTD PMID:27901495 URB1 Human benzo[e]pyrene decreases methylation EXP 6480464 benzo(e)pyrene results in decreased methylation of URB1 exon CTD PMID:30157460 URB1 Human bis(2-ethylhexyl) phthalate increases expression ISO Urb1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of URB1 mRNA CTD PMID:34319233 URB1 Human bisphenol A increases expression ISO Urb1 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of URB1 mRNA CTD PMID:25181051 URB1 Human bisphenol A increases methylation ISO Urb1 (Rattus norvegicus) 6480464 bisphenol A results in increased methylation of URB1 gene CTD PMID:28505145 URB1 Human bisphenol A multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of URB1 mRNA CTD PMID:28628672 URB1 Human bisphenol A decreases expression ISO Urb1 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of URB1 mRNA CTD PMID:30816183 and PMID:32528016 URB1 Human bisphenol F multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of URB1 mRNA CTD PMID:28628672 URB1 Human cisplatin decreases expression EXP 6480464 Cisplatin results in decreased expression of URB1 mRNA CTD PMID:27594783 URB1 Human crocidolite asbestos increases expression ISO Urb1 (Mus musculus) 6480464 Asbestos and Crocidolite results in increased expression of URB1 mRNA CTD PMID:19446018 URB1 Human dexamethasone multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of URB1 mRNA more ... CTD PMID:28628672 URB1 Human dicrotophos increases expression EXP 6480464 dicrotophos results in increased expression of URB1 mRNA CTD PMID:28302478 URB1 Human doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of URB1 mRNA CTD PMID:29803840 URB1 Human epoxiconazole decreases expression ISO Urb1 (Mus musculus) 6480464 epoxiconazole results in decreased expression of URB1 mRNA CTD PMID:35436446 URB1 Human genistein decreases expression ISO Urb1 (Rattus norvegicus) 6480464 Genistein results in decreased expression of URB1 protein CTD PMID:24552547 URB1 Human gentamycin increases expression ISO Urb1 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of URB1 mRNA CTD PMID:33387578 URB1 Human indometacin multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of URB1 mRNA more ... CTD PMID:28628672 URB1 Human ivermectin decreases expression EXP 6480464 Ivermectin results in decreased expression of URB1 protein CTD PMID:32959892 URB1 Human maneb multiple interactions ISO Urb1 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of URB1 mRNA CTD PMID:36117858 URB1 Human methapyrilene decreases methylation EXP 6480464 Methapyrilene results in decreased methylation of URB1 exon CTD PMID:30157460 URB1 Human methoxychlor affects methylation ISO Urb1 (Rattus norvegicus) 6480464 Methoxychlor affects the methylation of URB1 gene CTD PMID:35440735 URB1 Human omega-6 fatty acid decreases expression EXP 6480464 Fatty Acids and Omega-6 results in decreased expression of URB1 mRNA CTD PMID:16823509 URB1 Human paracetamol affects expression ISO Urb1 (Mus musculus) 6480464 Acetaminophen affects the expression of URB1 mRNA CTD PMID:17562736 URB1 Human paraquat multiple interactions ISO Urb1 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of URB1 mRNA CTD PMID:36117858 URB1 Human PCB138 multiple interactions ISO Urb1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 URB1 Human perfluorooctane-1-sulfonic acid multiple interactions ISO Urb1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of URB1 mRNA CTD PMID:36331819 URB1 Human potassium chromate increases expression EXP 6480464 potassium chromate(VI) results in increased expression of URB1 mRNA CTD PMID:22714537 URB1 Human sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of URB1 mRNA CTD PMID:38568856 URB1 Human sodium dichromate increases expression ISO Urb1 (Rattus norvegicus) 6480464 sodium bichromate results in increased expression of URB1 mRNA CTD PMID:25993096 URB1 Human sunitinib increases expression EXP 6480464 Sunitinib results in increased expression of URB1 mRNA CTD PMID:31533062 URB1 Human tetrachloromethane increases expression ISO Urb1 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of URB1 mRNA CTD PMID:31150632 URB1 Human tetrachloromethane multiple interactions ISO Urb1 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of URB1 mRNA] CTD PMID:31150632 URB1 Human thioacetamide increases expression ISO Urb1 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of URB1 mRNA CTD PMID:23411599 and PMID:34492290 URB1 Human titanium dioxide affects methylation ISO Urb1 (Mus musculus) 6480464 titanium dioxide affects the methylation of URB1 gene CTD PMID:35295148 URB1 Human titanium dioxide decreases methylation ISO Urb1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of URB1 promoter CTD PMID:35295148 URB1 Human triphenyl phosphate affects expression EXP 6480464 triphenyl phosphate affects the expression of URB1 mRNA CTD PMID:37042841 URB1 Human Triptolide increases expression ISO Urb1 (Mus musculus) 6480464 triptolide results in increased expression of URB1 mRNA CTD PMID:32835833 URB1 Human tungsten decreases expression ISO Urb1 (Mus musculus) 6480464 Tungsten results in decreased expression of URB1 mRNA CTD PMID:30912803
(+)-schisandrin B (ISO) 1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene (ISO) 1,2-dichloroethane (ISO) 1-chloro-2,4-dinitrobenzene (EXP) 17beta-estradiol (EXP) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,4,4'-trichlorobiphenyl (ISO) 3-isobutyl-1-methyl-7H-xanthine (EXP) 4,4'-sulfonyldiphenol (EXP) aflatoxin B1 (EXP) all-trans-retinoic acid (EXP) amphetamine (ISO) aristolochic acid A (EXP) arsenite(3-) (ISO) benzo[a]pyrene (EXP) benzo[e]pyrene (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (EXP) cisplatin (EXP) crocidolite asbestos (ISO) dexamethasone (EXP) dicrotophos (EXP) doxorubicin (EXP) epoxiconazole (ISO) genistein (ISO) gentamycin (ISO) indometacin (EXP) ivermectin (EXP) maneb (ISO) methapyrilene (EXP) methoxychlor (ISO) omega-6 fatty acid (EXP) paracetamol (ISO) paraquat (ISO) PCB138 (ISO) perfluorooctane-1-sulfonic acid (ISO) potassium chromate (EXP) sodium arsenite (EXP) sodium dichromate (ISO) sunitinib (EXP) tetrachloromethane (ISO) thioacetamide (ISO) titanium dioxide (ISO) triphenyl phosphate (EXP) Triptolide (ISO) tungsten (ISO)
URB1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 21 32,311,018 - 32,393,012 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 21 32,311,018 - 32,393,012 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 21 33,683,329 - 33,765,321 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 21 33,683,330 - 33,765,312 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 21 18,866,931 - 18,948,939 (-) NCBI Celera Cytogenetic Map 21 q22.11 NCBI HuRef 21 19,092,100 - 19,174,182 (-) NCBI HuRef CHM1_1 21 33,245,146 - 33,327,161 (-) NCBI CHM1_1 T2T-CHM13v2.0 21 30,680,775 - 30,762,860 (-) NCBI T2T-CHM13v2.0
Urb1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 16 90,548,415 - 90,607,312 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 16 90,548,415 - 90,607,301 (-) Ensembl GRCm39 Ensembl GRCm38 16 90,751,527 - 90,810,467 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 16 90,751,527 - 90,810,413 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 16 90,751,772 - 90,810,658 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 16 90,640,386 - 90,699,251 (-) NCBI MGSCv36 mm8 Celera 16 91,832,957 - 91,891,665 (-) NCBI Celera Cytogenetic Map 16 C3.3 NCBI cM Map 16 51.92 NCBI
Urb1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 11 43,490,633 - 43,551,398 (-) NCBI GRCr8 mRatBN7.2 11 30,004,539 - 30,065,315 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 11 30,004,539 - 30,065,363 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 11 38,690,104 - 38,750,824 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 11 31,361,515 - 31,422,227 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 11 30,536,196 - 30,596,923 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 11 30,916,740 - 30,977,423 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 11 30,916,730 - 30,977,483 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 11 34,528,215 - 34,588,898 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 11 30,732,790 - 30,793,473 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 11 30,738,941 - 30,818,441 (-) NCBI Celera 11 29,672,337 - 29,733,034 (-) NCBI Celera Cytogenetic Map 11 q11 NCBI
Urb1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955407 31,848,012 - 31,915,362 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955407 31,849,103 - 31,915,457 (-) NCBI ChiLan1.0 ChiLan1.0
URB1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 22 28,388,428 - 28,513,989 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 21 23,248,051 - 23,375,791 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 21 18,637,996 - 18,761,045 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 21 32,028,801 - 32,141,275 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 21 32,061,966 - 32,141,275 (-) Ensembl panpan1.1 panPan2
URB1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 31 27,087,196 - 27,158,144 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 31 27,087,570 - 27,158,164 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 31 27,080,534 - 27,151,483 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 31 27,207,657 - 27,278,618 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 31 27,207,735 - 27,278,625 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 31 27,152,622 - 27,223,569 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 31 27,164,342 - 27,235,271 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 31 27,672,375 - 27,742,811 (-) NCBI UU_Cfam_GSD_1.0
Urb1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404971 27,679,168 - 27,748,856 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936500 9,718,925 - 9,788,666 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936500 9,718,981 - 9,790,094 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
URB1
URB1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 2 59,733,260 - 59,811,990 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 2 59,733,902 - 59,814,018 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666071 2,275,305 - 2,354,903 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Urb1
.
Predicted Target Of
Count of predictions: 2178 Count of miRNA genes: 1091 Interacting mature miRNAs: 1331 Transcripts: ENST00000382751, ENST00000480196, ENST00000492603 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
597189800 GWAS1285874_H free androgen index QTL GWAS1285874 (human) 4e-14 free androgen index 21 32378323 32378324 Human 597607405 GWAS1664265_H squamous cell carcinoma QTL GWAS1664265 (human) 6e-12 squamous cell carcinoma 21 32353306 32353307 Human 597107283 GWAS1203357_H testosterone measurement QTL GWAS1203357 (human) 2e-13 testosterone measurement serum testosterone level (CMO:0000568) 21 32378323 32378324 Human 597190350 GWAS1286424_H testosterone measurement QTL GWAS1286424 (human) 1e-16 testosterone measurement serum testosterone level (CMO:0000568) 21 32378323 32378324 Human 597095614 GWAS1191688_H testosterone measurement QTL GWAS1191688 (human) 3e-20 testosterone measurement serum testosterone level (CMO:0000568) 21 32378323 32378324 Human 2303081 MAMTS49_H Mammary tumor susceptibility QTL 49 (human) 1.72 Mammary tumor susceptibility 21 17950448 43950448 Human 597152699 GWAS1248773_H lifestyle measurement, anxiety disorder measurement QTL GWAS1248773 (human) 2e-10 anxiety-related behavior trait (VT:0010716) 21 32317197 32317198 Human 597096633 GWAS1192707_H testosterone measurement QTL GWAS1192707 (human) 4e-31 testosterone measurement serum testosterone level (CMO:0000568) 21 32378323 32378324 Human
SHGC-87585
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,685,879 - 33,686,005 UniSTS GRCh37 Build 36 21 32,607,750 - 32,607,876 RGD NCBI36 Celera 21 18,869,480 - 18,869,606 RGD Cytogenetic Map 21 q22.11 UniSTS Cytogenetic Map 21 q22.1 UniSTS HuRef 21 19,094,649 - 19,094,775 UniSTS TNG Radiation Hybrid Map 21 10773.0 UniSTS GeneMap99-GB4 RH Map 21 164.65 UniSTS NCBI RH Map 21 227.0 UniSTS
D21S314
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,698,602 - 33,698,777 UniSTS GRCh37 GRCh37 21 33,698,605 - 33,698,912 UniSTS GRCh37 Build 36 21 32,620,476 - 32,620,783 RGD NCBI36 Celera 21 18,882,206 - 18,882,513 RGD Celera 21 18,882,203 - 18,882,378 UniSTS Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,107,373 - 19,107,548 UniSTS HuRef 21 19,107,376 - 19,107,683 UniSTS TNG Radiation Hybrid Map 21 10764.0 UniSTS Stanford-G3 RH Map 21 742.0 UniSTS
ECD00639
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,399 - 33,765,295 UniSTS GRCh37 Build 36 21 32,686,270 - 32,687,166 RGD NCBI36 Celera 21 18,948,026 - 18,948,922 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,269 - 19,174,165 UniSTS
ECD04303
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,289 - 33,751,057 UniSTS GRCh37 Build 36 21 32,672,160 - 32,672,928 RGD NCBI36 Celera 21 18,933,915 - 18,934,683 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,159,158 - 19,159,926 UniSTS
ECD05309
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,749,509 - 33,750,248 UniSTS GRCh37 Build 36 21 32,671,380 - 32,672,119 RGD NCBI36 Celera 21 18,933,135 - 18,933,874 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,158,378 - 19,159,117 UniSTS
ECD05563
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,223 - 33,747,955 UniSTS GRCh37 Build 36 21 32,669,094 - 32,669,826 RGD NCBI36 Celera 21 18,930,849 - 18,931,581 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,156,093 - 19,156,825 UniSTS
ECD05936
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,152 - 33,751,874 UniSTS GRCh37 Build 36 21 32,673,023 - 32,673,745 RGD NCBI36 Celera 21 18,934,778 - 18,935,500 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,160,021 - 19,160,743 UniSTS
ECD06160
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,396 - 33,758,112 UniSTS GRCh37 Build 36 21 32,679,267 - 32,679,983 RGD NCBI36 Celera 21 18,941,022 - 18,941,738 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,166,265 - 19,166,981 UniSTS
ECD06936
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,556 - 33,756,251 UniSTS GRCh37 Build 36 21 32,677,427 - 32,678,122 RGD NCBI36 Celera 21 18,939,182 - 18,939,877 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,164,425 - 19,165,120 UniSTS
ECD07444
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,753,084 - 33,753,765 UniSTS GRCh37 Build 36 21 32,674,955 - 32,675,636 RGD NCBI36 Celera 21 18,936,710 - 18,937,391 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,953 - 19,162,634 UniSTS
ECD07600
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,850 - 33,755,527 UniSTS GRCh37 Build 36 21 32,676,721 - 32,677,398 RGD NCBI36 Celera 21 18,938,476 - 18,939,153 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,719 - 19,164,396 UniSTS
ECD08047
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,158 - 33,754,823 UniSTS GRCh37 Build 36 21 32,676,029 - 32,676,694 RGD NCBI36 Celera 21 18,937,784 - 18,938,449 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,027 - 19,163,692 UniSTS
ECD08266
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,408 - 33,753,067 UniSTS GRCh37 Build 36 21 32,674,279 - 32,674,938 RGD NCBI36 Celera 21 18,936,034 - 18,936,693 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,277 - 19,161,936 UniSTS
ECD10199
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,499 - 33,766,107 UniSTS GRCh37 Build 36 21 32,687,370 - 32,687,978 RGD NCBI36 Celera 21 18,949,126 - 18,949,734 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,369 - 19,174,977 UniSTS
ECD10568
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,165 - 33,766,763 UniSTS GRCh37 Build 36 21 32,688,036 - 32,688,634 RGD NCBI36 Celera 21 18,949,792 - 18,950,390 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,035 - 19,175,633 UniSTS
ECD10886
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,393 - 33,756,981 UniSTS GRCh37 Build 36 21 32,678,264 - 32,678,852 RGD NCBI36 Celera 21 18,940,019 - 18,940,607 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,165,262 - 19,165,850 UniSTS
ECD18015
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,217 - 33,759,593 UniSTS GRCh37 Build 36 21 32,681,088 - 32,681,464 RGD NCBI36 Celera 21 18,942,843 - 18,943,219 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,086 - 19,168,462 UniSTS
ECD18144
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,748,318 - 33,748,689 UniSTS GRCh37 Build 36 21 32,670,189 - 32,670,560 RGD NCBI36 Celera 21 18,931,944 - 18,932,315 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,188 - 19,157,559 UniSTS
ECD19328
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,754 - 33,760,079 UniSTS GRCh37 Build 36 21 32,681,625 - 32,681,950 RGD NCBI36 Celera 21 18,943,380 - 18,943,706 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,623 - 19,168,949 UniSTS
ECD19944
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,762,351 - 33,762,654 UniSTS GRCh37 Build 36 21 32,684,222 - 32,684,525 RGD NCBI36 Celera 21 18,945,978 - 18,946,281 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,171,221 - 19,171,524 UniSTS
ECD20271
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,858 - 33,761,148 UniSTS GRCh37 Build 36 21 32,682,729 - 32,683,019 RGD NCBI36 Celera 21 18,944,485 - 18,944,775 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,728 - 19,170,018 UniSTS
ECD21182
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,974 - 33,767,232 UniSTS GRCh37 Build 36 21 32,688,845 - 32,689,103 RGD NCBI36 Celera 21 18,950,601 - 18,950,859 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,844 - 19,176,102 UniSTS
SHGC-57897
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,948 - 33,766,071 UniSTS GRCh37 Build 36 21 32,687,819 - 32,687,942 RGD NCBI36 Celera 21 18,949,575 - 18,949,698 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,818 - 19,174,941 UniSTS TNG Radiation Hybrid Map 21 10807.0 UniSTS
REN80729
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,746,183 - 33,746,410 UniSTS GRCh37 Build 36 21 32,668,054 - 32,668,281 RGD NCBI36 Celera 21 18,929,809 - 18,930,036 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,155,053 - 19,155,280 UniSTS
REN80730
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,746,401 - 33,746,663 UniSTS GRCh37 Build 36 21 32,668,272 - 32,668,534 RGD NCBI36 Celera 21 18,930,027 - 18,930,289 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,155,271 - 19,155,533 UniSTS
REN80731
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,746,640 - 33,746,866 UniSTS GRCh37 Build 36 21 32,668,511 - 32,668,737 RGD NCBI36 Celera 21 18,930,266 - 18,930,492 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,155,510 - 19,155,736 UniSTS
REN80732
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,746,855 - 33,747,103 UniSTS GRCh37 Build 36 21 32,668,726 - 32,668,974 RGD NCBI36 Celera 21 18,930,481 - 18,930,729 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,155,725 - 19,155,973 UniSTS
REN80733
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,099 - 33,747,354 UniSTS GRCh37 Build 36 21 32,668,970 - 32,669,225 RGD NCBI36 Celera 21 18,930,725 - 18,930,980 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,155,969 - 19,156,224 UniSTS
REN80734
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,343 - 33,747,585 UniSTS GRCh37 Build 36 21 32,669,214 - 32,669,456 RGD NCBI36 Celera 21 18,930,969 - 18,931,211 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,156,213 - 19,156,455 UniSTS
REN80735
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,576 - 33,747,800 UniSTS GRCh37 Build 36 21 32,669,447 - 32,669,671 RGD NCBI36 Celera 21 18,931,202 - 18,931,426 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,156,446 - 19,156,670 UniSTS
REN80736
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,774 - 33,748,017 UniSTS GRCh37 Build 36 21 32,669,645 - 32,669,888 RGD NCBI36 Celera 21 18,931,400 - 18,931,643 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,156,644 - 19,156,887 UniSTS
REN80737
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,747,959 - 33,748,201 UniSTS GRCh37 Build 36 21 32,669,830 - 32,670,072 RGD NCBI36 Celera 21 18,931,585 - 18,931,827 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,156,829 - 19,157,071 UniSTS
REN80738
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,748,177 - 33,748,447 UniSTS GRCh37 Build 36 21 32,670,048 - 32,670,318 RGD NCBI36 Celera 21 18,931,803 - 18,932,073 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,047 - 19,157,317 UniSTS
REN80739
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,748,419 - 33,748,665 UniSTS GRCh37 Build 36 21 32,670,290 - 32,670,536 RGD NCBI36 Celera 21 18,932,045 - 18,932,291 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,289 - 19,157,535 UniSTS
REN80740
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,748,642 - 33,748,866 UniSTS GRCh37 Build 36 21 32,670,513 - 32,670,737 RGD NCBI36 Celera 21 18,932,268 - 18,932,492 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,512 - 19,157,736 UniSTS
REN80741
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,748,836 - 33,749,101 UniSTS GRCh37 Build 36 21 32,670,707 - 32,670,972 RGD NCBI36 Celera 21 18,932,462 - 18,932,727 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,706 - 19,157,966 UniSTS
REN80742
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,749,100 - 33,749,351 UniSTS GRCh37 Build 36 21 32,670,971 - 32,671,222 RGD NCBI36 Celera 21 18,932,726 - 18,932,977 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,157,965 - 19,158,220 UniSTS
REN80743
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,749,343 - 33,749,596 UniSTS GRCh37 Build 36 21 32,671,214 - 32,671,467 RGD NCBI36 Celera 21 18,932,969 - 18,933,222 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,158,212 - 19,158,465 UniSTS
REN80744
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,749,575 - 33,749,836 UniSTS GRCh37 Build 36 21 32,671,446 - 32,671,707 RGD NCBI36 Celera 21 18,933,201 - 18,933,462 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,158,444 - 19,158,705 UniSTS
REN80745
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,749,813 - 33,750,074 UniSTS GRCh37 Build 36 21 32,671,684 - 32,671,945 RGD NCBI36 Celera 21 18,933,439 - 18,933,700 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,158,682 - 19,158,943 UniSTS
REN80746
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,051 - 33,750,276 UniSTS GRCh37 Build 36 21 32,671,922 - 32,672,147 RGD NCBI36 Celera 21 18,933,677 - 18,933,902 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,158,920 - 19,159,145 UniSTS
REN80747
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,254 - 33,750,511 UniSTS GRCh37 Build 36 21 32,672,125 - 32,672,382 RGD NCBI36 Celera 21 18,933,880 - 18,934,137 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,159,123 - 19,159,380 UniSTS
REN80748
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,488 - 33,750,733 UniSTS GRCh37 Build 36 21 32,672,359 - 32,672,604 RGD NCBI36 Celera 21 18,934,114 - 18,934,359 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,159,357 - 19,159,602 UniSTS
REN80749
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,710 - 33,750,959 UniSTS GRCh37 Build 36 21 32,672,581 - 32,672,830 RGD NCBI36 Celera 21 18,934,336 - 18,934,585 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,159,579 - 19,159,828 UniSTS
REN80750
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,935 - 33,751,197 UniSTS GRCh37 Build 36 21 32,672,806 - 32,673,068 RGD NCBI36 Celera 21 18,934,561 - 18,934,823 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,159,804 - 19,160,066 UniSTS
REN80751
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,182 - 33,751,426 UniSTS GRCh37 Build 36 21 32,673,053 - 32,673,297 RGD NCBI36 Celera 21 18,934,808 - 18,935,052 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,160,051 - 19,160,295 UniSTS
REN80752
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,416 - 33,751,675 UniSTS GRCh37 Build 36 21 32,673,287 - 32,673,546 RGD NCBI36 Celera 21 18,935,042 - 18,935,301 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,160,285 - 19,160,544 UniSTS
REN80753
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,652 - 33,751,884 UniSTS GRCh37 Build 36 21 32,673,523 - 32,673,755 RGD NCBI36 Celera 21 18,935,278 - 18,935,510 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,160,521 - 19,160,753 UniSTS
REN80754
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,754 - 33,751,995 UniSTS GRCh37 Build 36 21 32,673,625 - 32,673,866 RGD NCBI36 Celera 21 18,935,380 - 18,935,621 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,160,623 - 19,160,864 UniSTS
REN80755
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,185 - 33,752,420 UniSTS GRCh37 Build 36 21 32,674,056 - 32,674,291 RGD NCBI36 Celera 21 18,935,811 - 18,936,046 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,054 - 19,161,289 UniSTS
REN80756
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,409 - 33,752,659 UniSTS GRCh37 Build 36 21 32,674,280 - 32,674,530 RGD NCBI36 Celera 21 18,936,035 - 18,936,285 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,278 - 19,161,528 UniSTS
REN80757
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,608 - 33,752,868 UniSTS GRCh37 Build 36 21 32,674,479 - 32,674,739 RGD NCBI36 Celera 21 18,936,234 - 18,936,494 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,477 - 19,161,737 UniSTS
REN80758
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,845 - 33,753,104 UniSTS GRCh37 Build 36 21 32,674,716 - 32,674,975 RGD NCBI36 Celera 21 18,936,471 - 18,936,730 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,714 - 19,161,973 UniSTS
REN80759
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,753,081 - 33,753,332 UniSTS GRCh37 Build 36 21 32,674,952 - 32,675,203 RGD NCBI36 Celera 21 18,936,707 - 18,936,958 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,161,950 - 19,162,201 UniSTS
REN80760
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,753,315 - 33,753,564 UniSTS GRCh37 Build 36 21 32,675,186 - 32,675,435 RGD NCBI36 Celera 21 18,936,941 - 18,937,190 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,162,184 - 19,162,433 UniSTS
REN80761
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,753,539 - 33,753,784 UniSTS GRCh37 Build 36 21 32,675,410 - 32,675,655 RGD NCBI36 Celera 21 18,937,165 - 18,937,410 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,162,408 - 19,162,653 UniSTS
REN80762
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,753,754 - 33,754,006 UniSTS GRCh37 Build 36 21 32,675,625 - 32,675,877 RGD NCBI36 Celera 21 18,937,380 - 18,937,632 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,162,623 - 19,162,875 UniSTS
REN80763
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,000 - 33,754,247 UniSTS GRCh37 Build 36 21 32,675,871 - 32,676,118 RGD NCBI36 Celera 21 18,937,626 - 18,937,873 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,162,869 - 19,163,116 UniSTS
REN80764
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,221 - 33,754,458 UniSTS GRCh37 Build 36 21 32,676,092 - 32,676,329 RGD NCBI36 Celera 21 18,937,847 - 18,938,084 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,090 - 19,163,327 UniSTS
REN80765
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,435 - 33,754,665 UniSTS GRCh37 Build 36 21 32,676,306 - 32,676,536 RGD NCBI36 Celera 21 18,938,061 - 18,938,291 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,304 - 19,163,534 UniSTS
REN80766
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,645 - 33,754,910 UniSTS GRCh37 Build 36 21 32,676,516 - 32,676,781 RGD NCBI36 Celera 21 18,938,271 - 18,938,536 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,514 - 19,163,779 UniSTS
REN80767
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,854 - 33,755,105 UniSTS GRCh37 Build 36 21 32,676,725 - 32,676,976 RGD NCBI36 Celera 21 18,938,480 - 18,938,731 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,723 - 19,163,974 UniSTS
REN80768
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,091 - 33,755,335 UniSTS GRCh37 Build 36 21 32,676,962 - 32,677,206 RGD NCBI36 Celera 21 18,938,717 - 18,938,961 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,163,960 - 19,164,204 UniSTS
REN80769
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,321 - 33,755,584 UniSTS GRCh37 Build 36 21 32,677,192 - 32,677,455 RGD NCBI36 Celera 21 18,938,947 - 18,939,210 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,164,190 - 19,164,453 UniSTS
REN80770
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,576 - 33,755,800 UniSTS GRCh37 Build 36 21 32,677,447 - 32,677,671 RGD NCBI36 Celera 21 18,939,202 - 18,939,426 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,164,445 - 19,164,669 UniSTS
REN80771
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,792 - 33,756,051 UniSTS GRCh37 Build 36 21 32,677,663 - 32,677,922 RGD NCBI36 Celera 21 18,939,418 - 18,939,677 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,164,661 - 19,164,920 UniSTS
REN80772
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,029 - 33,756,266 UniSTS GRCh37 Build 36 21 32,677,900 - 32,678,137 RGD NCBI36 Celera 21 18,939,655 - 18,939,892 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,164,898 - 19,165,135 UniSTS
REN80773
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,248 - 33,756,512 UniSTS GRCh37 Build 36 21 32,678,119 - 32,678,383 RGD NCBI36 Celera 21 18,939,874 - 18,940,138 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,165,117 - 19,165,381 UniSTS
REN80774
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,511 - 33,756,762 UniSTS GRCh37 Build 36 21 32,678,382 - 32,678,633 RGD NCBI36 Celera 21 18,940,137 - 18,940,388 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,165,380 - 19,165,631 UniSTS
REN80775
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,734 - 33,756,993 UniSTS GRCh37 Build 36 21 32,678,605 - 32,678,864 RGD NCBI36 Celera 21 18,940,360 - 18,940,619 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,165,603 - 19,165,862 UniSTS
REN80776
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,790 - 33,757,014 UniSTS GRCh37 Build 36 21 32,678,661 - 32,678,885 RGD NCBI36 Celera 21 18,940,416 - 18,940,640 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,165,659 - 19,165,883 UniSTS
REN80777
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,328 - 33,757,556 UniSTS GRCh37 Build 36 21 32,679,199 - 32,679,427 RGD NCBI36 Celera 21 18,940,954 - 18,941,182 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,166,197 - 19,166,425 UniSTS
REN80778
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,547 - 33,757,808 UniSTS GRCh37 Build 36 21 32,679,418 - 32,679,679 RGD NCBI36 Celera 21 18,941,173 - 18,941,434 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,166,416 - 19,166,677 UniSTS
REN80779
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,787 - 33,758,049 UniSTS GRCh37 Build 36 21 32,679,658 - 32,679,920 RGD NCBI36 Celera 21 18,941,413 - 18,941,675 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,166,656 - 19,166,918 UniSTS
REN80780
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,946 - 33,758,179 UniSTS GRCh37 Build 36 21 32,679,817 - 32,680,050 RGD NCBI36 Celera 21 18,941,572 - 18,941,805 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,166,815 - 19,167,048 UniSTS
REN80781
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,758,360 - 33,758,608 UniSTS GRCh37 Build 36 21 32,680,231 - 32,680,479 RGD NCBI36 Celera 21 18,941,986 - 18,942,234 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,167,229 - 19,167,477 UniSTS
REN80782
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,758,597 - 33,758,850 UniSTS GRCh37 Build 36 21 32,680,468 - 32,680,721 RGD NCBI36 Celera 21 18,942,223 - 18,942,476 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,167,466 - 19,167,719 UniSTS
REN80783
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,758,828 - 33,759,071 UniSTS GRCh37 Build 36 21 32,680,699 - 32,680,942 RGD NCBI36 Celera 21 18,942,454 - 18,942,697 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,167,697 - 19,167,940 UniSTS
REN80784
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,066 - 33,759,336 UniSTS GRCh37 Build 36 21 32,680,937 - 32,681,207 RGD NCBI36 Celera 21 18,942,692 - 18,942,962 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,167,935 - 19,168,205 UniSTS
REN80785
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,332 - 33,759,595 UniSTS GRCh37 Build 36 21 32,681,203 - 32,681,466 RGD NCBI36 Celera 21 18,942,958 - 18,943,221 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,201 - 19,168,464 UniSTS
REN80786
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,567 - 33,759,808 UniSTS GRCh37 Build 36 21 32,681,438 - 32,681,679 RGD NCBI36 Celera 21 18,943,193 - 18,943,434 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,436 - 19,168,677 UniSTS
REN80787
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,774 - 33,760,015 UniSTS GRCh37 Build 36 21 32,681,645 - 32,681,886 RGD NCBI36 Celera 21 18,943,400 - 18,943,642 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,643 - 19,168,885 UniSTS
REN80788
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,990 - 33,760,234 UniSTS GRCh37 Build 36 21 32,681,861 - 32,682,105 RGD NCBI36 Celera 21 18,943,617 - 18,943,861 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,168,860 - 19,169,104 UniSTS
REN80789
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,211 - 33,760,459 UniSTS GRCh37 Build 36 21 32,682,082 - 32,682,330 RGD NCBI36 Celera 21 18,943,838 - 18,944,086 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,081 - 19,169,329 UniSTS
REN80790
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,441 - 33,760,665 UniSTS GRCh37 Build 36 21 32,682,312 - 32,682,536 RGD NCBI36 Celera 21 18,944,068 - 18,944,292 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,311 - 19,169,535 UniSTS
REN80791
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,642 - 33,760,903 UniSTS GRCh37 Build 36 21 32,682,513 - 32,682,774 RGD NCBI36 Celera 21 18,944,269 - 18,944,530 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,512 - 19,169,773 UniSTS
REN80792
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,881 - 33,761,131 UniSTS GRCh37 Build 36 21 32,682,752 - 32,683,002 RGD NCBI36 Celera 21 18,944,508 - 18,944,758 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,751 - 19,170,001 UniSTS
REN80793
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,761,108 - 33,761,334 UniSTS GRCh37 Build 36 21 32,682,979 - 32,683,205 RGD NCBI36 Celera 21 18,944,735 - 18,944,961 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,169,978 - 19,170,204 UniSTS
REN80794
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,761,310 - 33,761,560 UniSTS GRCh37 Build 36 21 32,683,181 - 32,683,431 RGD NCBI36 Celera 21 18,944,937 - 18,945,187 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,170,180 - 19,170,430 UniSTS
REN80795
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,761,540 - 33,761,794 UniSTS GRCh37 Build 36 21 32,683,411 - 32,683,665 RGD NCBI36 Celera 21 18,945,167 - 18,945,421 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,170,410 - 19,170,664 UniSTS
REN80796
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,761,771 - 33,762,025 UniSTS GRCh37 Build 36 21 32,683,642 - 32,683,896 RGD NCBI36 Celera 21 18,945,398 - 18,945,652 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,170,641 - 19,170,895 UniSTS
REN80797
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,762,006 - 33,762,230 UniSTS GRCh37 Build 36 21 32,683,877 - 32,684,101 RGD NCBI36 Celera 21 18,945,633 - 18,945,857 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,170,876 - 19,171,100 UniSTS
REN80798
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,762,220 - 33,762,472 UniSTS GRCh37 Build 36 21 32,684,091 - 32,684,343 RGD NCBI36 Celera 21 18,945,847 - 18,946,099 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,171,090 - 19,171,342 UniSTS
REN80799
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,762,429 - 33,762,679 UniSTS GRCh37 Build 36 21 32,684,300 - 32,684,550 RGD NCBI36 Celera 21 18,946,056 - 18,946,306 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,171,299 - 19,171,549 UniSTS
REN80800
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,763,687 - 33,763,920 UniSTS GRCh37 Build 36 21 32,685,558 - 32,685,791 RGD NCBI36 Celera 21 18,947,314 - 18,947,547 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,172,557 - 19,172,790 UniSTS
REN80801
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,763,858 - 33,764,101 UniSTS GRCh37 Build 36 21 32,685,729 - 32,685,972 RGD NCBI36 Celera 21 18,947,485 - 18,947,728 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,172,728 - 19,172,971 UniSTS
REN80802
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,763,999 - 33,764,223 UniSTS GRCh37 Build 36 21 32,685,870 - 32,686,094 RGD NCBI36 Celera 21 18,947,626 - 18,947,850 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,172,869 - 19,173,093 UniSTS
REN80803
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,194 - 33,764,453 UniSTS GRCh37 Build 36 21 32,686,065 - 32,686,324 RGD NCBI36 Celera 21 18,947,821 - 18,948,080 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,064 - 19,173,323 UniSTS
REN80804
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,415 - 33,764,664 UniSTS GRCh37 Build 36 21 32,686,286 - 32,686,535 RGD NCBI36 Celera 21 18,948,042 - 18,948,291 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,285 - 19,173,534 UniSTS
REN80805
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,636 - 33,764,870 UniSTS GRCh37 Build 36 21 32,686,507 - 32,686,741 RGD NCBI36 Celera 21 18,948,263 - 18,948,497 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,506 - 19,173,740 UniSTS
REN80806
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,847 - 33,765,118 UniSTS GRCh37 Build 36 21 32,686,718 - 32,686,989 RGD NCBI36 Celera 21 18,948,474 - 18,948,745 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,717 - 19,173,988 UniSTS
REN80807
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,901 - 33,765,145 UniSTS GRCh37 Build 36 21 32,686,772 - 32,687,016 RGD NCBI36 Celera 21 18,948,528 - 18,948,772 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,173,771 - 19,174,015 UniSTS
REN80808
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,240 - 33,765,473 UniSTS GRCh37 Build 36 21 32,687,111 - 32,687,344 RGD NCBI36 Celera 21 18,948,867 - 18,949,100 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,110 - 19,174,343 UniSTS
REN80809
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,465 - 33,765,723 UniSTS GRCh37 Build 36 21 32,687,336 - 32,687,594 RGD NCBI36 Celera 21 18,949,092 - 18,949,350 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,335 - 19,174,593 UniSTS
REN80810
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,702 - 33,765,951 UniSTS GRCh37 Build 36 21 32,687,573 - 32,687,822 RGD NCBI36 Celera 21 18,949,329 - 18,949,578 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,572 - 19,174,821 UniSTS
REN80811
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,936 - 33,766,161 UniSTS GRCh37 Build 36 21 32,687,807 - 32,688,032 RGD NCBI36 Celera 21 18,949,563 - 18,949,788 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,174,806 - 19,175,031 UniSTS
REN80812
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,130 - 33,766,392 UniSTS GRCh37 Build 36 21 32,688,001 - 32,688,263 RGD NCBI36 Celera 21 18,949,757 - 18,950,019 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,000 - 19,175,262 UniSTS
REN80813
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,377 - 33,766,631 UniSTS GRCh37 Build 36 21 32,688,248 - 32,688,502 RGD NCBI36 Celera 21 18,950,004 - 18,950,258 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,247 - 19,175,501 UniSTS
REN80814
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,619 - 33,766,885 UniSTS GRCh37 Build 36 21 32,688,490 - 32,688,756 RGD NCBI36 Celera 21 18,950,246 - 18,950,512 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,489 - 19,175,755 UniSTS
REN80815
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,766,857 - 33,767,092 UniSTS GRCh37 Build 36 21 32,688,728 - 32,688,963 RGD NCBI36 Celera 21 18,950,484 - 18,950,719 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,727 - 19,175,962 UniSTS
REN80816
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,767,041 - 33,767,300 UniSTS GRCh37 Build 36 21 32,688,912 - 32,689,171 RGD NCBI36 Celera 21 18,950,668 - 18,950,927 RGD Cytogenetic Map 21 q22.11 UniSTS HuRef 21 19,175,911 - 19,176,170 UniSTS
stSG606350
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,750,790 - 33,751,865 UniSTS GRCh37 Build 36 21 32,672,661 - 32,673,736 RGD NCBI36 Celera 21 18,934,416 - 18,935,491 RGD HuRef 21 19,159,659 - 19,160,734 UniSTS
stSG606351
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,751,849 - 33,752,870 UniSTS GRCh37 Build 36 21 32,673,720 - 32,674,741 RGD NCBI36 Celera 21 18,935,475 - 18,936,496 RGD HuRef 21 19,160,718 - 19,161,739 UniSTS
stSG606352
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,752,862 - 33,754,177 UniSTS GRCh37 Build 36 21 32,674,733 - 32,676,048 RGD NCBI36 Celera 21 18,936,488 - 18,937,803 RGD HuRef 21 19,161,731 - 19,163,046 UniSTS
stSG606353
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,158 - 33,754,373 UniSTS GRCh37 Build 36 21 32,676,029 - 32,676,244 RGD NCBI36 Celera 21 18,937,784 - 18,937,999 RGD HuRef 21 19,163,027 - 19,163,242 UniSTS
stSG606354
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,754,375 - 33,755,575 UniSTS GRCh37 Build 36 21 32,676,246 - 32,677,446 RGD NCBI36 Celera 21 18,938,001 - 18,939,201 RGD HuRef 21 19,163,244 - 19,164,444 UniSTS
stSG606355
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,755,556 - 33,756,586 UniSTS GRCh37 Build 36 21 32,677,427 - 32,678,457 RGD NCBI36 Celera 21 18,939,182 - 18,940,212 RGD HuRef 21 19,164,425 - 19,165,455 UniSTS
stSG606356
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,756,567 - 33,757,978 UniSTS GRCh37 Build 36 21 32,678,438 - 32,679,849 RGD NCBI36 Celera 21 18,940,193 - 18,941,604 RGD HuRef 21 19,165,436 - 19,166,847 UniSTS
stSG606357
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,757,964 - 33,759,423 UniSTS GRCh37 Build 36 21 32,679,835 - 32,681,294 RGD NCBI36 Celera 21 18,941,590 - 18,943,049 RGD HuRef 21 19,166,833 - 19,168,292 UniSTS
stSG606358
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,759,471 - 33,760,721 UniSTS GRCh37 Build 36 21 32,681,342 - 32,682,592 RGD NCBI36 Celera 21 18,943,097 - 18,944,348 RGD HuRef 21 19,168,340 - 19,169,591 UniSTS
stSG606359
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,760,702 - 33,761,939 UniSTS GRCh37 Build 36 21 32,682,573 - 32,683,810 RGD NCBI36 Celera 21 18,944,329 - 18,945,566 RGD HuRef 21 19,169,572 - 19,170,809 UniSTS
stSG606360
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,761,920 - 33,762,651 UniSTS GRCh37 Build 36 21 32,683,791 - 32,684,522 RGD NCBI36 Celera 21 18,945,547 - 18,946,278 RGD HuRef 21 19,170,790 - 19,171,521 UniSTS
stSG606361
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,764,402 - 33,765,482 UniSTS GRCh37 Build 36 21 32,686,273 - 32,687,353 RGD NCBI36 Celera 21 18,948,029 - 18,949,109 RGD HuRef 21 19,173,272 - 19,174,352 UniSTS
stSG606362
Human Assembly Chr Position (strand) Source JBrowse GRCh37 21 33,765,499 - 33,766,550 UniSTS GRCh37 Build 36 21 32,687,370 - 32,688,421 RGD NCBI36 Celera 21 18,949,126 - 18,950,177 RGD HuRef 21 19,174,369 - 19,175,420 UniSTS
D21S314
Human Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 21 q22.11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
entire extraembryonic component
1204
2439
2788
2253
4974
1726
2351
6
624
1950
465
2270
7305
6471
53
3734
1
852
1744
1617
175
1
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENST00000382751 ⟹ ENSP00000372199
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 21 32,311,018 - 32,393,012 (-) Ensembl
Ensembl Acc Id:
ENST00000480196
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 21 32,333,113 - 32,334,334 (-) Ensembl
Ensembl Acc Id:
ENST00000492603
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 21 32,334,209 - 32,335,630 (-) Ensembl
RefSeq Acc Id:
NM_014825 ⟹ NP_055640
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 21 32,311,018 - 32,393,012 (-) NCBI GRCh37 21 33,683,330 - 33,765,312 (-) RGD Celera 21 18,866,931 - 18,948,939 (-) RGD HuRef 21 19,092,100 - 19,174,182 (-) RGD CHM1_1 21 33,245,146 - 33,327,161 (-) NCBI T2T-CHM13v2.0 21 30,680,775 - 30,762,860 (-) NCBI
Sequence:
CTGCGCCATGTGGGCCTGAAGCGCGTGTCTGCTGTCTGTGCCAGTGCTCCTGCCGGGTCCCCTCAGGTGTGTCGTTTCCGTCGCGCTTCCGCCCTCTCGGCCATGGGGGTCCCCAAGAGGAAGGCCTC
hide sequence
RefSeq Acc Id:
NP_055640 ⟸ NM_014825
- UniProtKB:
Q96NX1 (UniProtKB/Swiss-Prot), D3DSE5 (UniProtKB/Swiss-Prot), Q9NYQ1 (UniProtKB/Swiss-Prot), O60287 (UniProtKB/Swiss-Prot)
- Sequence:
MGVPKRKASGGQDGAASSAGAAKRARKEELTGVRFKAQLKDPQGPGPGLEAFVSAAKKLPREDVYDVVEGYIKISVECVEIFQLLSGEKRPESETMLIFQVFEAILLRTASDLSHFHVVGTNIVKKLM
hide sequence
Ensembl Acc Id:
ENSP00000372199 ⟸ ENST00000382751
RGD ID: 13602624 Promoter ID: EPDNEW_H27496 Type: initiation region Name: URB1_1 Description: URB1 ribosome biogenesis 1 homolog SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 21 32,393,012 - 32,393,072 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2018-08-14
URB1
URB1 ribosome biogenesis homolog
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Symbol and/or name change
5135510 APPROVED
