REN80772 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: REN80772

Symbol: REN80772
Previously known as:
RGD ID: 2019648
Expected Size: 238 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372133,756,029 - 33,756,266UniSTSGRCh37
Build 362132,677,900 - 32,678,137RGDNCBI36
Celera2118,939,655 - 18,939,892RGD
Cytogenetic Map21q22.11UniSTS
HuRef2119,164,898 - 19,165,135UniSTS
Is Marker For: Genes:   URB1  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer GCATAAAGATTCAAAATAACGCTAAAA
Reverse Primer TCAGAAAACCATGGAATCTGGATA
 


1 to 19 of 19 rows
GenBank Nucleotide AP000033 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP000103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP000179 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP000268 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP001714 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BA000005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003516 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000272 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000482 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000511 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000683 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001629.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486043 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990681 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000151 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583260 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976414.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 19 of 19 rows



Database
Acc Id
Source(s)
NCBI Gene 9875 UniSTS