Symbol:
Paxip1
Name:
PAX interacting protein 1
RGD ID:
1307547
Description:
Predicted to be involved in several processes, including DNA damage response, signal transduction by p53 class mediator; regulation of primary metabolic process; and vasculogenesis. Predicted to act upstream of or within DNA damage response. Predicted to be part of MLL3/4 complex. Predicted to be active in nucleus. Orthologous to human PAXIP1 (PAX interacting protein 1); PARTICIPATES IN histone modification pathway; INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; bisphenol A; flutamide.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC311944; PAX interacting (with transcription-activation domain) protein 1; PAX-interacting protein 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 8,258,930 - 8,310,490 (+) NCBI GRCr8 mRatBN7.2 4 7,525,132 - 7,576,659 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 7,525,004 - 7,576,548 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 12,535,163 - 12,586,700 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 8,349,408 - 8,400,945 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 6,695,594 - 6,747,133 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 3,956,931 - 4,008,326 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 3,959,640 - 4,008,326 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 3,996,608 - 4,047,988 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 2,790,532 - 2,839,246 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 2,717,068 - 2,839,242 (+) NCBI Celera 4 2,704,414 - 2,753,568 (-) NCBI Celera Cytogenetic Map 4 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Paxip1 Rat autistic disorder ISO RGD:1316804 8554872 ClinVar Annotator: match by term: Autism ClinVar PMID:21681106|PMID:30208311 Paxip1 Rat holoprosencephaly 3 ISO RGD:1316804 8554872 ClinVar Annotator: match by term: Holoprosencephaly 3 ClinVar PMID:10631160|PMID:10749657|PMID:16254195|PMID:19603532|PMID:20425842|PMID:21976454|PMID:23370340|PMID:24095820|PMID:28492532|PMID:29992659|PMID:31334757
Only show annotations with direct experimental evidence (0 objects hidden)
Paxip1 Rat 1,2-dimethylhydrazine decreases expression ISO RGD:1316805 6480464 1,2-Dimethylhydrazine results in decreased expression of PAXIP1 mRNA CTD PMID:22206623 Paxip1 Rat 17alpha-ethynylestradiol multiple interactions ISO RGD:1316805 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PAXIP1 mRNA CTD PMID:17942748 Paxip1 Rat 17beta-estradiol affects expression ISO RGD:1316804 6480464 Estradiol affects the expression of PAXIP1 mRNA CTD PMID:22574217 Paxip1 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression EXP 6480464 2,2',4,4'-tetrabromodiphenyl ether results in increased expression of PAXIP1 mRNA CTD PMID:27291303 Paxip1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:1316805 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PAXIP1 mRNA; Tetrachlorodibenzodioxin promotes the more ... CTD PMID:17942748|PMID:19654925 Paxip1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1316805 6480464 Tetrachlorodibenzodioxin affects the expression of PAXIP1 mRNA CTD PMID:26377647 Paxip1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1316805 6480464 Tetrachlorodibenzodioxin results in increased expression of PAXIP1 mRNA CTD PMID:17942748|PMID:19465110 Paxip1 Rat 2-butoxyethanol increases expression ISO RGD:1316805 6480464 n-butoxyethanol results in increased expression of PAXIP1 mRNA CTD PMID:19812364 Paxip1 Rat 4,4'-sulfonyldiphenol decreases expression ISO RGD:1316805 6480464 bisphenol S results in decreased expression of PAXIP1 mRNA CTD PMID:39298647 Paxip1 Rat 4-hydroxyphenyl retinamide increases expression ISO RGD:1316805 6480464 Fenretinide results in increased expression of PAXIP1 mRNA CTD PMID:28973697 Paxip1 Rat aflatoxin B1 increases methylation ISO RGD:1316804 6480464 Aflatoxin B1 results in increased methylation of PAXIP1 gene CTD PMID:27153756 Paxip1 Rat aristolochic acid A decreases expression ISO RGD:1316804 6480464 aristolochic acid I results in decreased expression of PAXIP1 mRNA CTD PMID:33212167 Paxip1 Rat arsane multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat arsenic atom multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO RGD:1316804 6480464 7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in decreased expression of PAXIP1 mRNA CTD PMID:20382639 Paxip1 Rat bisphenol A increases expression ISO RGD:1316805 6480464 bisphenol A results in increased expression of PAXIP1 mRNA CTD PMID:26063408 Paxip1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PAXIP1 mRNA CTD PMID:25181051 Paxip1 Rat cadmium dichloride decreases expression ISO RGD:1316804 6480464 Cadmium Chloride results in decreased expression of PAXIP1 mRNA CTD PMID:38568856 Paxip1 Rat cadmium sulfate multiple interactions ISO RGD:1316805 6480464 cadmium sulfate affects the reaction [MTF1 affects the expression of PAXIP1 mRNA] CTD PMID:16221973 Paxip1 Rat CGP 52608 multiple interactions ISO RGD:1316804 6480464 CGP 52608 promotes the reaction [RORA protein binds to PAXIP1 gene] CTD PMID:28238834 Paxip1 Rat chlorpyrifos decreases expression ISO RGD:1316805 6480464 Chlorpyrifos results in decreased expression of PAXIP1 mRNA CTD PMID:37019170 Paxip1 Rat cobalt dichloride decreases expression ISO RGD:1316804 6480464 cobaltous chloride results in decreased expression of PAXIP1 mRNA CTD PMID:19320972 Paxip1 Rat copper atom multiple interactions ISO RGD:1316804 6480464 [NSC 689534 binds to Copper] which results in decreased expression of PAXIP1 mRNA CTD PMID:20971185 Paxip1 Rat copper(0) multiple interactions ISO RGD:1316804 6480464 [NSC 689534 binds to Copper] which results in decreased expression of PAXIP1 mRNA CTD PMID:20971185 Paxip1 Rat copper(II) sulfate decreases expression ISO RGD:1316804 6480464 Copper Sulfate results in decreased expression of PAXIP1 mRNA CTD PMID:19549813 Paxip1 Rat coumarin decreases phosphorylation ISO RGD:1316804 6480464 coumarin results in decreased phosphorylation of PAXIP1 protein CTD PMID:35688186 Paxip1 Rat cyclosporin A decreases expression ISO RGD:1316804 6480464 Cyclosporine results in decreased expression of PAXIP1 mRNA CTD PMID:25562108 Paxip1 Rat cyclosporin A increases methylation ISO RGD:1316804 6480464 Cyclosporine results in increased methylation of PAXIP1 promoter CTD PMID:27989131 Paxip1 Rat Dibutyl phosphate affects expression ISO RGD:1316804 6480464 di-n-butylphosphoric acid affects the expression of PAXIP1 mRNA CTD PMID:37042841 Paxip1 Rat doxorubicin decreases expression ISO RGD:1316804 6480464 Doxorubicin results in decreased expression of PAXIP1 mRNA CTD PMID:29803840 Paxip1 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of PAXIP1 mRNA CTD PMID:24136188 Paxip1 Rat folic acid decreases expression ISO RGD:1316805 6480464 Folic Acid results in decreased expression of PAXIP1 mRNA CTD PMID:25629700 Paxip1 Rat formaldehyde decreases expression ISO RGD:1316804 6480464 Formaldehyde results in decreased expression of PAXIP1 mRNA CTD PMID:20655997 Paxip1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of PAXIP1 mRNA CTD PMID:33387578 Paxip1 Rat manganese atom multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat manganese(0) multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat manganese(II) chloride multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat menadione affects expression ISO RGD:1316804 6480464 Vitamin K 3 affects the expression of PAXIP1 mRNA CTD PMID:20044591 Paxip1 Rat methylseleninic acid decreases expression ISO RGD:1316804 6480464 methylselenic acid results in decreased expression of PAXIP1 mRNA CTD PMID:18548127 Paxip1 Rat N,N-diethyl-m-toluamide multiple interactions EXP 6480464 [Permethrin co-treated with DEET] affects the methylation of PAXIP1 gene CTD PMID:33148267 Paxip1 Rat oxaliplatin decreases expression EXP 6480464 oxaliplatin results in decreased expression of PAXIP1 mRNA CTD PMID:25729387 Paxip1 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of PAXIP1 mRNA CTD PMID:25729387 Paxip1 Rat ozone multiple interactions ISO RGD:1316804 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of PAXIP1 mRNA CTD PMID:35430440 Paxip1 Rat paracetamol affects expression ISO RGD:1316805 6480464 Acetaminophen affects the expression of PAXIP1 mRNA CTD PMID:17562736 Paxip1 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of PAXIP1 mRNA CTD PMID:33387578 Paxip1 Rat permethrin multiple interactions EXP 6480464 [Permethrin co-treated with DEET] affects the methylation of PAXIP1 gene CTD PMID:33148267 Paxip1 Rat piroxicam decreases expression ISO RGD:1316804 6480464 Piroxicam results in decreased expression of PAXIP1 mRNA CTD PMID:21858171 Paxip1 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of PAXIP1 mRNA CTD PMID:28374803 Paxip1 Rat serpentine asbestos affects methylation ISO RGD:1316804 6480464 Asbestos, Serpentine affects the methylation of PAXIP1 gene CTD PMID:29523930 Paxip1 Rat sodium arsenite decreases expression ISO RGD:1316804 6480464 sodium arsenite results in decreased expression of PAXIP1 mRNA CTD PMID:38568856 Paxip1 Rat sodium arsenite multiple interactions ISO RGD:1316804 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased more ... CTD PMID:39836092 Paxip1 Rat sunitinib increases expression ISO RGD:1316804 6480464 Sunitinib results in increased expression of PAXIP1 mRNA CTD PMID:31533062 Paxip1 Rat temozolomide decreases expression ISO RGD:1316804 6480464 Temozolomide results in decreased expression of PAXIP1 mRNA CTD PMID:31758290 Paxip1 Rat tert-butyl hydroperoxide decreases expression ISO RGD:1316804 6480464 tert-Butylhydroperoxide results in decreased expression of PAXIP1 mRNA CTD PMID:15336504 Paxip1 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of PAXIP1 mRNA CTD PMID:25729387 Paxip1 Rat trimellitic anhydride increases expression ISO RGD:1316805 6480464 trimellitic anhydride results in increased expression of PAXIP1 mRNA CTD PMID:19042947 Paxip1 Rat vinclozolin increases expression EXP 6480464 vinclozolin results in increased expression of PAXIP1 mRNA CTD PMID:23034163
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Paxip1 Rat protein binding enables ISO RGD:1316805 1624291 UniProtKB:P32114|UniProtKB:P32114-2|UniProtKB:Q02650|UniProtKB:Q12888|UniProtKB:Q99L02|UniProtKB:Q9BTK6 PMID:10908331, PMID:17500065, PMID:17925232, PMID:19124460, PMID:21552207, PMID:26744420 RGD PMID:10908331|PMID:17500065|PMID:17925232|PMID:19124460|PMID:21552207|PMID:26744420 Paxip1 Rat protein binding enables ISO RGD:1316804,UniProtKB:Q6ZW49-1 1624291 UniProtKB:P16104 PMID:22064073 RGD PMID:22064073 Paxip1 Rat protein binding enables ISO RGD:1316804,UniProtKB:Q6ZW49-2 1624291 UniProtKB:Q15555|UniProtKB:Q96HA1|UniProtKB:Q9UKK6 PMID:25416956 RGD PMID:25416956 Paxip1 Rat protein binding enables ISO RGD:1316804 1624291 UniProtKB:O60356|UniProtKB:P05067|UniProtKB:P48730-2|UniProtKB:P61964|UniProtKB:Q12888|UniProtKB:Q15291|UniProtKB:Q9BTK6|UniProtKB:Q9UBL3 PMID:11940591, PMID:15456759, PMID:17178841, PMID:17500065, PMID:17925232, PMID:19124460, PMID:24981860, PMID:27705803, PMID:28514442, PMID:32814053, PMID:33961781 RGD PMID:11940591|PMID:15456759|PMID:17178841|PMID:17500065|PMID:17925232|PMID:19124460|PMID:24981860|PMID:27705803|PMID:28514442|PMID:32814053|PMID:33961781
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2-butoxyethanol (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) aflatoxin B1 (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) benzo[a]pyrene diol epoxide I (ISO) bisphenol A (EXP,ISO) cadmium dichloride (ISO) cadmium sulfate (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) coumarin (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) doxorubicin (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) gentamycin (EXP) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) menadione (ISO) methylseleninic acid (ISO) N,N-diethyl-m-toluamide (EXP) oxaliplatin (EXP) ozone (ISO) paracetamol (EXP,ISO) permethrin (EXP) piroxicam (ISO) rotenone (EXP) serpentine asbestos (ISO) sodium arsenite (ISO) sunitinib (ISO) temozolomide (ISO) tert-butyl hydroperoxide (ISO) topotecan (EXP) trimellitic anhydride (ISO) vinclozolin (EXP)
Paxip1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 8,258,930 - 8,310,490 (+) NCBI GRCr8 mRatBN7.2 4 7,525,132 - 7,576,659 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 7,525,004 - 7,576,548 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 12,535,163 - 12,586,700 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 8,349,408 - 8,400,945 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 6,695,594 - 6,747,133 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 3,956,931 - 4,008,326 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 3,959,640 - 4,008,326 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 3,996,608 - 4,047,988 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 2,790,532 - 2,839,246 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 2,717,068 - 2,839,242 (+) NCBI Celera 4 2,704,414 - 2,753,568 (-) NCBI Celera Cytogenetic Map 4 q11 NCBI
PAXIP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 154,943,690 - 155,003,411 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 154,943,687 - 155,003,124 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 154,735,400 - 154,794,834 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 154,366,333 - 154,425,615 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 154,173,048 - 154,232,306 NCBI Celera 7 149,152,557 - 149,211,836 (-) NCBI Celera Cytogenetic Map 7 q36.2 NCBI HuRef 7 148,468,426 - 148,527,705 (-) NCBI HuRef CHM1_1 7 154,743,784 - 154,803,135 (-) NCBI CHM1_1 T2T-CHM13v2.0 7 156,118,967 - 156,178,685 (-) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 153,963,422 - 154,022,702 (-) NCBI
Paxip1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 27,947,044 - 27,999,326 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 27,945,078 - 27,996,689 (-) Ensembl GRCm39 Ensembl GRCm38 5 27,740,080 - 27,791,672 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 27,740,080 - 27,791,691 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 28,067,205 - 28,117,879 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 28,071,452 - 28,122,126 (-) NCBI MGSCv36 mm8 Celera 5 25,287,864 - 25,339,859 (-) NCBI Celera Cytogenetic Map 5 B1 NCBI cM Map 5 13.23 NCBI
Paxip1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955491 8,177,422 - 8,219,766 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955491 8,177,422 - 8,219,764 (-) NCBI ChiLan1.0 ChiLan1.0
PAXIP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 191,372,868 - 191,432,198 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 43,383,480 - 43,442,465 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 146,546,658 - 146,605,912 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 158,274,193 - 158,329,139 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 7 158,276,798 - 158,330,911 (-) Ensembl panpan1.1 panPan2
PAXIP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 16 18,066,289 - 18,116,007 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 16 18,066,246 - 18,112,506 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 16 18,699,205 - 18,749,159 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 16 19,794,777 - 19,844,723 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 19,794,777 - 19,844,705 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 16 18,166,085 - 18,216,026 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 16 18,746,356 - 18,796,284 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 16 18,799,076 - 18,849,057 (-) NCBI UU_Cfam_GSD_1.0
Paxip1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 3,415,214 - 3,463,432 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936527 9,440,036 - 9,484,245 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936527 9,440,129 - 9,488,215 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PAXIP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 18 3,066,848 - 3,111,240 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 18 3,066,853 - 3,111,239 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 18 3,227,951 - 3,250,496 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PAXIP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 21 123,095,968 - 123,156,157 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 21 123,095,966 - 123,155,800 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666072 19,215,604 - 19,275,681 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Paxip1
.
Predicted Target Of
Count of predictions: 40 Count of miRNA genes: 39 Interacting mature miRNAs: 40 Transcripts: ENSRNOT00000009439 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
61408 Scl23 Serum cholesterol level QTL 23 0.0005 blood HDL phospholipid amount (VT:0010504) serum high density lipoprotein phospholipid level (CMO:0001567) 4 1 27716890 Rat 2302371 Stl22 Serum triglyceride level QTL 22 5.15 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 57114705 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 9589046 Scfw2 Subcutaneous fat weight QTL 2 5.54 0.001 subcutaneous adipose mass (VT:1000472) abdominal subcutaneous fat pad weight (CMO:0002069) 4 1 31934116 Rat 8552903 Pigfal2 Plasma insulin-like growth factor 1 level QTL 2 7.3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 4 1 31934116 Rat 724557 Plsm1 Polydactyly-luxate syndrome (PLS) morphotypes QTL 1 0.0003 forelimb integrity trait (VT:0010562) front foot phalanges count (CMO:0001947) 4 1 27716890 Rat 9590100 Sffal4 Serum free fatty acids level QTL 4 7.36 0.05 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 4 1 31934116 Rat 61351 Bp33 Blood pressure QTL 33 0.0018 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 1 27716890 Rat 61415 Eae11 Experimental allergic encephalomyelitis QTL 11 2.9 nervous system integrity trait (VT:0010566) post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422) 4 1 39505420 Rat 1641905 Colcr1 Colorectal carcinoma resistance QTL 1 4.3 0.0003 intestine integrity trait (VT:0010554) benign colorectal tumor surface area measurement (CMO:0001799) 4 1 29494328 Rat 1357341 Gluco5 Glucose level QTL 5 6.4 adipocyte free fatty acid secretion trait (VT:0010465) absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446) 4 1 33250345 Rat 619616 Bp79 Blood pressure QTL 79 0.0292 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 5214602 78882945 Rat 1357343 Gluco4 Glucose level QTL 4 0.00002 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874) 4 1 33250345 Rat 1358201 Gluco12 Glucose level QTL12 1.6 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake (CMO:0000870) 4 5218392 29593287 Rat 738021 Hcar13 Hepatocarcinoma resistance QTL 13 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 4 1 32584199 Rat 1358203 Stl19 Serum triglyceride level QTL 19 2.8 0.002 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 65958103 Rat 631642 Stl2 Serum triglyceride level QTL 2 3.3 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5219178 56647776 Rat 61333 Gluco16 Glucose level QTL 16 4.3 0.00001 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 1 30372989 Rat 634323 Hc2 Hypercalciuria QTL 2 2.15 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 4 210796 45210796 Rat 9589097 Slep11 Serum leptin concentration QTL 11 5.09 0.001 blood leptin amount (VT:0005667) plasma leptin level (CMO:0000781) 4 1 31934116 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000009439 ⟹ ENSRNOP00000009439
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 7,525,004 - 7,575,997 (+) Ensembl Rnor_6.0 Ensembl 4 3,959,640 - 4,008,326 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000099077 ⟹ ENSRNOP00000081191
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 7,530,970 - 7,575,997 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000104160 ⟹ ENSRNOP00000097277
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 7,525,128 - 7,576,548 (+) Ensembl
RefSeq Acc Id:
NM_001107844 ⟹ NP_001101314
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 8,258,966 - 8,310,490 (+) NCBI mRatBN7.2 4 7,525,132 - 7,576,659 (+) NCBI Rnor_6.0 4 3,959,640 - 4,008,326 (+) NCBI Rnor_5.0 4 3,996,608 - 4,047,988 (+) NCBI RGSC_v3.4 4 2,790,532 - 2,839,246 (+) RGD Celera 4 2,704,414 - 2,753,568 (-) RGD
Sequence:
GTTATTCAGCTTCTTAAAGCTGGGAAAGCCAAGGAAGTCTCCTACAACGCTCTGGCCTCTCACATCATTTCGGAGGATGGTGACAACCCAGAGGTGGGAGAAGCCCGTGAGGTCTTTGACTTGCCCGT
hide sequence
RefSeq Acc Id:
XM_063285937 ⟹ XP_063142007
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 8,258,930 - 8,310,490 (+) NCBI
RefSeq Acc Id:
XM_063285938 ⟹ XP_063142008
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 8,258,930 - 8,310,490 (+) NCBI
RefSeq Acc Id:
XM_063285939 ⟹ XP_063142009
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 8,259,253 - 8,310,490 (+) NCBI
RefSeq Acc Id:
NP_001101314 ⟸ NM_001107844
- UniProtKB:
A0A8I5ZSF2 (UniProtKB/TrEMBL)
- Sequence:
MFDDSSDSSPEKQERSLNWAPAEAPPLSTAQHRLPQGKGPGLINLCANVPPVPGDILPPDMRGNLMAAGQNLQSSERPEMLGTWSPAVRTLRNITNNADIQQISRPSNVAHILQSLSAPTKNLEQQVA
hide sequence
Ensembl Acc Id:
ENSRNOP00000009439 ⟸ ENSRNOT00000009439
Ensembl Acc Id:
ENSRNOP00000081191 ⟸ ENSRNOT00000099077
Ensembl Acc Id:
ENSRNOP00000097277 ⟸ ENSRNOT00000104160
RefSeq Acc Id:
XP_063142007 ⟸ XM_063285937
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZSF2 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063142008 ⟸ XM_063285938
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZSF2 (UniProtKB/TrEMBL), D3ZSX6 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063142009 ⟸ XM_063285939
- Peptide Label:
isoform X3
- UniProtKB:
A6KJK7 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-03-22
Paxip1
PAX interacting protein 1
Paxip1
PAX interacting (with transcription-activation domain) protein 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Paxip1
PAX interacting (with transcription-activation domain) protein 1
Paxip1_predicted
PAX interacting (with transcription-activation domain) protein 1 (predicted)
'predicted' is removed
2292626 APPROVED
2008-01-09
Paxip1_predicted
PAX interacting (with transcription-activation domain) protein 1 (predicted)
LOC681792
similar to Pax transcription activation domain interacting protein
Data merged from RGD:1591614
1643240 APPROVED
2006-11-20
LOC681792
similar to Pax transcription activation domain interacting protein
Symbol and Name status set to provisional
70820 PROVISIONAL
2005-01-12
Paxip1_predicted
PAX interacting (with transcription-activation domain) protein 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
