Symbol:
A2m
Name:
alpha-2-macroglobulin
RGD ID:
2004
Description:
Enables endopeptidase inhibitor activity; identical protein binding activity; and neurotrophin binding activity. Involved in several processes, including acute inflammatory response; embryonic liver development; and luteinization. Located in extracellular space. Used to study hemolytic anemia and toxic shock syndrome. Biomarker of several diseases, including liver disease (multiple); membranous glomerulonephritis; osteonecrosis; peritonitis; and trypanosomiasis. Human ortholog(s) of this gene implicated in COVID-19; background diabetic retinopathy; multiple sclerosis; neurodegenerative disease (multiple); and obstructive lung disease. Orthologous to human A2M (alpha-2-macroglobulin); PARTICIPATES IN transforming growth factor-beta Smad dependent signaling pathway; Alzheimer's disease pathway; immune response pathway; INTERACTS WITH (+)-pilocarpine; (+)-schisandrin B; (S)-amphetamine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
A2m1; A2maa; A2MAC1; A2mb; AI893533; alpha-2-M; alpha-2-macroglobulin-like; alpha-2-macroglobulin-P; LOC100911545; Mam; MGC114358; RATA2MAC1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
A2M (alpha-2-macroglobulin) HGNC
Ensembl, HomoloGene, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
A2m (alpha-2-macroglobulin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
LOC102021956 (alpha-2-macroglobulin) RGD
RGD
Pan paniscus (bonobo/pygmy chimpanzee):
LOC100979269 (alpha-2-macroglobulin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
A2M (alpha-2-macroglobulin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
LOC101959212 (alpha-2-macroglobulin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
A2M (alpha-2-macroglobulin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
PZP (PZP alpha-2-macroglobulin like) HGNC
OrthoDB, Panther
Alliance orthologs 3
Mus musculus (house mouse):
A2m (alpha-2-macroglobulin)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
A2M (alpha-2-macroglobulin)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
sb:cb37
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
zgc:171446
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
zgc:165453
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
a2ml (alpha-2-macroglobulin-like)
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
zgc:171445
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
si:dkey-46g23.2
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
si:dkey-105h12.2
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
si:dkey-46g23.5
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
si:ch211-212c13.10
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
a2m
Alliance
DIOPT (OMA|OrthoFinder|PANTHER)
Is Marker For:
QTLs:
Plsm2
Candidate Gene For:
Plsm2 Bp353
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 156,570,163 - 156,619,870 (+) NCBI GRCr8 mRatBN7.2 4 154,897,770 - 154,947,787 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 154,897,877 - 154,947,786 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 161,158,697 - 161,208,341 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 156,942,158 - 156,991,802 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 155,571,666 - 155,634,340 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 154,309,426 - 154,359,138 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 154,309,426 - 154,359,137 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 154,423,209 - 154,472,924 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 221,393,233 - 221,442,945 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 158,103,711 - 158,153,423 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 158,348,624 - 158,398,358 (+) NCBI Celera 4 143,730,195 - 143,781,190 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
A2m Rat (+)-pilocarpine increases expression EXP 6480464 Pilocarpine results in increased expression of A2M mRNA CTD PMID:17971868 A2m Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of A2M mRNA] CTD PMID:31150632 A2m Rat (S)-amphetamine increases expression EXP 6480464 Dextroamphetamine results in increased expression of A2M mRNA CTD PMID:16715494 A2m Rat 1-methylphenanthrene multiple interactions ISO A2M (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with 1-methylphenanthrene] affects the expression of A2M mRNA CTD PMID:17690111 A2m Rat 1-naphthyl isothiocyanate increases expression EXP 6480464 1-Naphthylisothiocyanate results in increased expression of A2M mRNA CTD PMID:12883083 and PMID:25380136 A2m Rat 1-naphthyl isothiocyanate affects expression EXP 6480464 1-Naphthylisothiocyanate affects the expression of A2M mRNA CTD PMID:18289764 A2m Rat 17alpha-ethynylestradiol decreases expression EXP 6480464 Ethinyl Estradiol results in decreased expression of A2M mRNA CTD PMID:17557909 A2m Rat 17beta-estradiol affects expression EXP 6480464 Estradiol affects the expression of A2M mRNA CTD PMID:32145629 A2m Rat 17beta-estradiol multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of A2M mRNA CTD PMID:32741896 A2m Rat 17beta-estradiol 3-benzoate increases methylation EXP 6480464 estradiol 3-benzoate results in increased methylation of A2M promoter CTD PMID:27415467 A2m Rat 17beta-estradiol 3-benzoate multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of A2M mRNA CTD PMID:32741896 A2m Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO A2m (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of A2M mRNA CTD PMID:19770486 and PMID:33956508 A2m Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of A2M mRNA CTD PMID:34747641 A2m Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of A2M mRNA CTD PMID:21215274 more ... A2m Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 AHR protein alternative form affects the reaction [Tetrachlorodibenzodioxin results in decreased expression of A2M mRNA] CTD PMID:21215274 A2m Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of A2M mRNA CTD PMID:21346803 A2m Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of A2M mRNA CTD PMID:21346803 A2m Rat 2-deoxy-D-glucose increases uptake ISO A2M (Homo sapiens) 6480464 A2M protein modified form results in increased uptake of Deoxyglucose CTD PMID:25720493 A2m Rat 2-deoxy-D-glucose multiple interactions ISO A2M (Homo sapiens) 6480464 HSPA5 protein affects the reaction [A2M protein modified form results in increased uptake of Deoxyglucose] CTD PMID:25720493 A2m Rat 2-hydroxypropanoic acid increases secretion ISO A2M (Homo sapiens) 6480464 A2M protein modified form results in increased secretion of Lactic Acid CTD PMID:25720493 A2m Rat 2-hydroxypropanoic acid multiple interactions ISO A2M (Homo sapiens) 6480464 HSPA5 protein affects the reaction [A2M protein modified form results in increased secretion of Lactic Acid] CTD PMID:25720493 A2m Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression EXP 6480464 3 more ... CTD PMID:19692669 A2m Rat 3-chloropropane-1,2-diol decreases expression EXP 6480464 alpha-Chlorohydrin results in decreased expression of A2M mRNA CTD PMID:28522335 A2m Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO A2M (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of A2M mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of A2M mRNA CTD PMID:28628672 A2m Rat 3H-1,2-dithiole-3-thione increases expression EXP 6480464 1 and 2-dithiol-3-thione results in increased expression of A2M mRNA CTD PMID:19162173 A2m Rat 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of A2M mRNA CTD PMID:18289764 A2m Rat 4,4'-sulfonyldiphenol multiple interactions ISO A2M (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of A2M mRNA CTD PMID:28628672 A2m Rat 6-aminohexanoate decreases expression ISO A2M (Homo sapiens) 6480464 Aminocaproic Acid results in decreased expression of A2M protein CTD PMID:11304663 A2m Rat 6-aminohexanoic acid decreases expression ISO A2M (Homo sapiens) 6480464 Aminocaproic Acid results in decreased expression of A2M protein CTD PMID:11304663 A2m Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of A2M mRNA CTD PMID:24780913 A2m Rat 7-nitroindazole increases activity EXP 6480464 7-nitroindazole results in increased activity of A2M CTD PMID:19240864 A2m Rat acrylamide decreases expression ISO A2m (Mus musculus) 6480464 Acrylamide results in decreased expression of A2M mRNA CTD PMID:35032568 A2m Rat Actein increases expression EXP 6480464 actein results in increased expression of A2M mRNA and actein results in increased expression of A2M protein CTD PMID:19527300 and PMID:29969672 A2m Rat aflatoxin B1 decreases expression ISO A2m (Mus musculus) 6480464 Aflatoxin B1 results in decreased expression of A2M mRNA CTD PMID:19770486 A2m Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of A2M mRNA CTD PMID:25378103 A2m Rat aflatoxin B1 decreases expression ISO A2M (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of A2M mRNA CTD PMID:27153756 A2m Rat aflatoxin B1 decreases methylation ISO A2M (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of A2M gene CTD PMID:27153756 A2m Rat aldehydo-D-glucose multiple interactions ISO A2m (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in decreased expression of A2M mRNA CTD PMID:37567420 A2m Rat all-trans-retinoic acid decreases expression ISO A2M (Homo sapiens) 6480464 Tretinoin results in decreased expression of A2M protein CTD PMID:30093655 A2m Rat all-trans-retinoic acid multiple interactions ISO A2m (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of A2M mRNA CTD PMID:36189433 A2m Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of A2M protein CTD PMID:34896426 A2m Rat allopurinol increases expression EXP 6480464 Allopurinol results in increased expression of A2M mRNA CTD PMID:37876353 A2m Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of A2M mRNA CTD PMID:16483693 A2m Rat antimony(0) decreases expression ISO A2M (Homo sapiens) 6480464 Antimony results in decreased expression of A2M mRNA CTD PMID:17547211 A2m Rat apigenin multiple interactions EXP 6480464 Apigenin inhibits the reaction [Cadmium Chloride results in increased expression of A2M protein] CTD PMID:15618353 A2m Rat arotinoid acid multiple interactions ISO A2M (Homo sapiens) 6480464 [4-(2-(5 more ... CTD PMID:34480604 A2m Rat arsenous acid decreases expression ISO A2M (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of A2M protein CTD PMID:30093655 A2m Rat bacitracin increases expression EXP 6480464 Bacitracin results in increased expression of A2M mRNA CTD PMID:18289764 A2m Rat benzo[a]pyrene increases expression ISO A2M (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of A2M mRNA CTD PMID:22316170 A2m Rat benzo[a]pyrene increases methylation ISO A2M (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of A2M exon and Benzo(a)pyrene results in increased methylation of A2M promoter CTD PMID:27901495 A2m Rat benzo[a]pyrene multiple interactions ISO A2M (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with 1 more ... CTD PMID:17690111 A2m Rat beta-naphthoflavone decreases expression EXP 6480464 beta-Naphthoflavone results in decreased expression of A2M mRNA CTD PMID:12883083 A2m Rat bis(2-ethylhexyl) phthalate multiple interactions ISO A2m (Mus musculus) 6480464 Diethylhexyl Phthalate inhibits the reaction [[Streptozocin co-treated with Dietary Fats] results in increased expression of A2M mRNA] CTD PMID:33484791 A2m Rat bis(2-ethylhexyl) phthalate decreases expression ISO A2M (Homo sapiens) 6480464 Diethylhexyl Phthalate results in decreased expression of A2M mRNA CTD PMID:31163220 A2m Rat bis(2-ethylhexyl) phthalate increases expression ISO A2m (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of A2M mRNA CTD PMID:33484791 A2m Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of A2M mRNA CTD PMID:25181051 and PMID:32145629 A2m Rat bisphenol A decreases expression ISO A2m (Mus musculus) 6480464 bisphenol A results in decreased expression of A2M mRNA CTD PMID:32156529 and PMID:35479511 A2m Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of A2M mRNA CTD PMID:34947998 A2m Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of A2M mRNA CTD PMID:30816183 A2m Rat bisphenol A affects expression ISO A2M (Homo sapiens) 6480464 bisphenol A affects the expression of A2M mRNA CTD PMID:30903817 A2m Rat bisphenol A increases methylation ISO A2m (Mus musculus) 6480464 bisphenol A results in increased methylation of A2M promoter CTD PMID:27312807 A2m Rat bisphenol A multiple interactions ISO A2M (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of A2M mRNA CTD PMID:28628672 A2m Rat cadmium atom affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Cadmium CTD PMID:23896426 A2m Rat cadmium atom multiple interactions ISO A2M (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of A2M mRNA CTD PMID:36602393 A2m Rat cadmium dichloride multiple interactions EXP 6480464 Apigenin inhibits the reaction [Cadmium Chloride results in increased expression of A2M protein] more ... CTD PMID:15618353 A2m Rat cadmium dichloride multiple interactions ISO A2M (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of A2M mRNA CTD PMID:36602393 A2m Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of A2M mRNA and Cadmium Chloride results in increased expression of A2M protein CTD PMID:15618353 and PMID:25993096 A2m Rat carbon nanotube increases expression ISO A2m (Mus musculus) 6480464 Nanotubes and Carbon results in increased expression of A2M CTD PMID:21654424 A2m Rat carbonyl sulfide increases expression EXP 6480464 carbonyl sulfide results in increased expression of A2M mRNA CTD PMID:19395590 A2m Rat carnosic acid decreases expression ISO A2m (Mus musculus) 6480464 salvin results in decreased expression of A2M protein CTD PMID:35926579 A2m Rat CHIR 99021 multiple interactions ISO A2M (Homo sapiens) 6480464 [4-(2-(5 more ... CTD PMID:34480604 A2m Rat chlorohydrocarbon multiple interactions EXP 6480464 [Hydrocarbons more ... CTD PMID:30744511 A2m Rat chlorpyrifos increases expression ISO A2m (Mus musculus) 6480464 Chlorpyrifos results in increased expression of A2M mRNA CTD PMID:32715474 A2m Rat cholate multiple interactions EXP 6480464 [cocoa butter co-treated with Cholesterol more ... CTD PMID:25814186 A2m Rat cisplatin affects binding ISO A2M (Homo sapiens) 6480464 Cisplatin binds to A2M protein CTD PMID:16773208 A2m Rat cisplatin increases expression EXP 6480464 Cisplatin results in increased expression of A2M mRNA CTD PMID:18289764 A2m Rat clofibrate increases expression EXP 6480464 Clofibrate results in increased expression of A2M mRNA CTD PMID:12883083 A2m Rat clofibric acid affects expression EXP 6480464 Clofibric Acid affects the expression of A2M mRNA CTD PMID:17602206 A2m Rat copper atom increases expression EXP 6480464 Copper results in increased expression of A2M mRNA CTD PMID:22465980 A2m Rat copper atom affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Copper CTD PMID:23896426 A2m Rat copper(0) increases expression EXP 6480464 Copper results in increased expression of A2M mRNA CTD PMID:22465980 A2m Rat copper(0) affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Copper CTD PMID:23896426 A2m Rat copper(II) sulfate decreases expression ISO A2M (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of A2M mRNA CTD PMID:19549813 A2m Rat corosolic acid increases expression ISO A2M (Homo sapiens) 6480464 corosolic acid results in increased expression of A2M mRNA CTD PMID:37939859 A2m Rat corticosterone increases expression EXP 6480464 Corticosterone results in increased expression of A2M mRNA CTD PMID:15755911 A2m Rat cortisol multiple interactions ISO A2M (Homo sapiens) 6480464 [4-(2-(5 more ... CTD PMID:34480604 A2m Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of A2M mRNA CTD PMID:27523638 A2m Rat cyclosporin A increases expression EXP 6480464 Cyclosporine results in increased expression of A2M mRNA CTD PMID:21865292 A2m Rat cyclosporin A decreases expression ISO A2M (Homo sapiens) 6480464 Cyclosporine results in decreased expression of A2M mRNA CTD PMID:20106945 more ... A2m Rat cyclosporin A decreases expression ISO A2m (Mus musculus) 6480464 Cyclosporine results in decreased expression of A2M mRNA CTD PMID:19770486 A2m Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of A2M protein CTD PMID:34896426 A2m Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of A2M protein CTD PMID:34896426 A2m Rat D-glucose multiple interactions ISO A2m (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in decreased expression of A2M mRNA CTD PMID:37567420 A2m Rat dexamethasone decreases expression EXP 6480464 Dexamethasone results in decreased expression of A2M mRNA CTD PMID:12971794 A2m Rat dexamethasone multiple interactions ISO A2M (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of A2M mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of A2M mRNA CTD PMID:28628672 A2m Rat dexamethasone increases expression ISO A2M (Homo sapiens) 6480464 Dexamethasone results in increased expression of A2M mRNA CTD PMID:25047013 A2m Rat diarsenic trioxide decreases expression ISO A2M (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of A2M protein CTD PMID:30093655 A2m Rat dibenz[a,h]anthracene multiple interactions ISO A2M (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with 1 more ... CTD PMID:17690111 A2m Rat dibenzo[a,l]pyrene multiple interactions ISO A2M (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with dibenzo(a and l)pyrene] affects the expression of A2M mRNA CTD PMID:17690111 A2m Rat dichloroacetic acid decreases expression ISO A2m (Mus musculus) 6480464 Dichloroacetic Acid results in decreased expression of A2M mRNA CTD PMID:28962523 A2m Rat diclofenac increases expression ISO A2m (Mus musculus) 6480464 Diclofenac results in increased expression of A2M mRNA CTD PMID:26934552 A2m Rat dimethyl sulfoxide increases expression EXP 6480464 Dimethyl Sulfoxide results in increased expression of A2M mRNA CTD PMID:12883083 A2m Rat dimethylarsinic acid decreases expression EXP 6480464 Cacodylic Acid results in decreased expression of A2M mRNA CTD PMID:37567419 A2m Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of A2M mRNA CTD PMID:33729688 A2m Rat dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate decreases expression ISO A2M (Homo sapiens) 6480464 Antimony Potassium Tartrate results in decreased expression of A2M mRNA CTD PMID:17547211 A2m Rat diuron decreases expression ISO A2M (Homo sapiens) 6480464 Diuron results in decreased expression of A2M mRNA CTD PMID:35967413 A2m Rat dorsomorphin multiple interactions ISO A2M (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of A2M mRNA CTD PMID:27188386 A2m Rat doxorubicin decreases expression ISO A2M (Homo sapiens) 6480464 Doxorubicin results in decreased expression of A2M mRNA CTD PMID:29803840 A2m Rat elemental selenium increases expression ISO A2M (Homo sapiens) 6480464 Selenium results in increased expression of A2M mRNA CTD PMID:18997278 A2m Rat elemental selenium multiple interactions ISO A2M (Homo sapiens) 6480464 Selenium inhibits the reaction [T-2 Toxin results in decreased expression of A2M mRNA] and Selenium promotes the reaction [T-2 Toxin results in decreased expression of A2M protein] CTD PMID:21144892 A2m Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of A2M mRNA CTD PMID:29391264 A2m Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of A2M protein CTD PMID:34896426 A2m Rat fluoranthene multiple interactions ISO A2M (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with fluoranthene] affects the expression of A2M mRNA CTD PMID:17690111 A2m Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of A2M mRNA CTD PMID:24136188 A2m Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of A2M mRNA CTD PMID:24793618 A2m Rat fructose multiple interactions ISO A2m (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in decreased expression of A2M mRNA CTD PMID:37567420 A2m Rat furan decreases expression EXP 6480464 furan results in decreased expression of A2M mRNA CTD PMID:15120968 A2m Rat furan increases expression EXP 6480464 furan results in increased expression of A2M mRNA CTD PMID:26194646 A2m Rat gemcitabine increases expression ISO A2M (Homo sapiens) 6480464 Gemcitabine results in increased expression of A2M protein CTD PMID:20531411 A2m Rat genistein decreases expression ISO A2m (Mus musculus) 6480464 Genistein results in decreased expression of A2M mRNA CTD PMID:32186404 A2m Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of A2M mRNA CTD PMID:33387578 A2m Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of A2M mRNA CTD PMID:24136188 A2m Rat glucose multiple interactions ISO A2m (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in decreased expression of A2M mRNA CTD PMID:37567420 A2m Rat glycidyl methacrylate increases expression ISO A2M (Homo sapiens) 6480464 glycidyl methacrylate results in increased expression of A2M protein CTD PMID:36641056 A2m Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of A2M mRNA CTD PMID:21396975 A2m Rat indometacin multiple interactions ISO A2M (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of A2M mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of A2M mRNA CTD PMID:28628672 A2m Rat irinotecan increases expression EXP 6480464 Irinotecan results in increased expression of A2M mRNA CTD PMID:20097248 A2m Rat isoniazide increases expression EXP 6480464 Isoniazid results in increased expression of A2M mRNA CTD PMID:12883083 A2m Rat isoprenaline increases expression ISO A2m (Mus musculus) 6480464 Isoproterenol results in increased expression of A2M mRNA CTD PMID:21335049 A2m Rat isotretinoin increases expression ISO A2M (Homo sapiens) 6480464 Isotretinoin results in increased expression of A2M mRNA CTD PMID:20436886 A2m Rat ketoconazole decreases expression EXP 6480464 Ketoconazole results in decreased expression of A2M mRNA CTD PMID:18289764 A2m Rat L-ascorbic acid multiple interactions ISO A2M (Homo sapiens) 6480464 [[Ascorbic Acid co-treated with Chir 99021 co-treated with XAV939 co-treated with BMP4 protein co-treated with FGF1 protein co-treated with WNT3A protein co-treated with HGF protein] co-treated with [INHBA protein binds to INHBA protein]] results in increased expression of A2M mRNA CTD PMID:34480604 A2m Rat L-ascorbic acid 2-phosphate multiple interactions ISO A2M (Homo sapiens) 6480464 [[ascorbate-2-phosphate co-treated with Chir 99021 co-treated with XAV939 co-treated with BMP4 protein] co-treated with [INHBA protein binds to INHBA protein]] results in increased expression of A2M mRNA CTD PMID:34480604 A2m Rat lead diacetate affects expression EXP 6480464 lead acetate affects the expression of A2M mRNA CTD PMID:21864555 A2m Rat lead diacetate decreases expression EXP 6480464 lead acetate results in decreased expression of A2M mRNA CTD PMID:22641619 A2m Rat lead(0) affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Lead CTD PMID:23896426 A2m Rat lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of A2M mRNA CTD PMID:11779202 A2m Rat lipopolysaccharide increases expression ISO A2m (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of A2M mRNA CTD PMID:27339419 A2m Rat melamine increases expression EXP 6480464 melamine results in increased expression of A2M CTD PMID:23052191 A2m Rat menadione affects expression ISO A2M (Homo sapiens) 6480464 Vitamin K 3 affects the expression of A2M mRNA CTD PMID:20044591 A2m Rat mercury atom decreases expression ISO A2M (Homo sapiens) 6480464 Mercury results in decreased expression of A2M mRNA CTD PMID:17547211 A2m Rat mercury dichloride increases expression ISO A2M (Homo sapiens) 6480464 Mercuric Chloride results in increased expression of A2M mRNA CTD PMID:27188386 A2m Rat mercury(0) decreases expression ISO A2M (Homo sapiens) 6480464 Mercury results in decreased expression of A2M mRNA CTD PMID:17547211 A2m Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of A2M mRNA CTD PMID:15120968 A2m Rat methylmercury chloride increases expression EXP 6480464 methylmercuric chloride results in increased expression of A2M mRNA CTD PMID:31378766 A2m Rat methylmercury chloride multiple interactions EXP 6480464 [Hydrocarbons more ... CTD PMID:30744511 A2m Rat mono(2-ethylhexyl) phthalate increases expression EXP 6480464 mono-(2-ethylhexyl)phthalate results in increased expression of A2M mRNA CTD PMID:38113427 A2m Rat mono(2-ethylhexyl) phthalate multiple interactions ISO A2m (Mus musculus) 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of A2M mRNA CTD PMID:36189433 A2m Rat N(6),N(6)-dimethyladenine multiple interactions EXP 6480464 N(6) and N(6)-dimethyladenine inhibits the reaction [Cadmium Chloride results in increased expression of A2M protein] CTD PMID:15618353 A2m Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in increased expression of A2M mRNA more ... CTD PMID:20360939 more ... A2m Rat N-nitrosodiethylamine increases expression EXP 6480464 Diethylnitrosamine results in increased expression of A2M mRNA and Diethylnitrosamine results in increased expression of A2M protein CTD PMID:27565560 and PMID:29698782 A2m Rat N-nitrosodiethylamine decreases expression EXP 6480464 Diethylnitrosamine results in decreased expression of A2M mRNA CTD PMID:20360939 A2m Rat N-nitrosodimethylamine increases expression EXP 6480464 Dimethylnitrosamine results in increased expression of A2M mRNA CTD PMID:25380136 A2m Rat N-nitrosodimethylamine decreases expression ISO A2M (Homo sapiens) 6480464 Dimethylnitrosamine results in decreased expression of A2M mRNA CTD PMID:17547211 A2m Rat naphthalene affects binding ISO A2m (Mus musculus) 6480464 naphthalene metabolite binds to A2M protein CTD PMID:15892573 A2m Rat naphthalene increases expression EXP 6480464 naphthalene analog results in increased expression of A2M mRNA CTD PMID:24976557 A2m Rat nickel atom affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Nickel CTD PMID:23896426 A2m Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of A2M mRNA CTD PMID:33484710 A2m Rat obeticholic acid decreases expression ISO A2M (Homo sapiens) 6480464 obeticholic acid results in decreased expression of A2M mRNA CTD PMID:27939613 A2m Rat ochratoxin A increases expression EXP 6480464 ochratoxin A results in increased expression of A2M mRNA CTD PMID:12700408 A2m Rat ochratoxin A decreases expression ISO A2M (Homo sapiens) 6480464 ochratoxin A results in decreased expression of A2M mRNA CTD PMID:30008028 A2m Rat olanzapine affects phosphorylation ISO A2M (Homo sapiens) 6480464 olanzapine affects the phosphorylation of A2M protein CTD PMID:25821032 A2m Rat orphenadrine affects expression EXP 6480464 Orphenadrine affects the expression of A2M mRNA CTD PMID:23665939 A2m Rat ouabain affects expression ISO A2M (Homo sapiens) 6480464 Ouabain affects the expression of A2M protein CTD PMID:17268060 A2m Rat ozone multiple interactions ISO A2M (Homo sapiens) 6480464 [Ozone results in increased abundance of Soot metabolite] which results in decreased expression of A2M mRNA CTD PMID:28410501 A2m Rat ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of A2M mRNA and [Air Pollutants results in increased abundance of Ozone] which results in increased expression of A2M protein CTD PMID:33317425 A2m Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of A2M mRNA CTD PMID:12883083 and PMID:8878780 A2m Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of A2M mRNA CTD PMID:33387578 A2m Rat perfluorobutyric acid decreases expression ISO A2M (Homo sapiens) 6480464 perfluorobutyric acid results in decreased expression of A2M mRNA CTD PMID:36251517 A2m Rat perfluorodecanoic acid increases expression ISO A2m (Mus musculus) 6480464 perfluorodecanoic acid results in increased expression of A2M mRNA CTD PMID:23567314 A2m Rat perfluorohexanesulfonic acid increases expression ISO A2m (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of A2M mRNA CTD PMID:37995155 A2m Rat perfluorooctane-1-sulfonic acid affects expression ISO A2m (Mus musculus) 6480464 perfluorooctane sulfonic acid affects the expression of A2M mRNA CTD PMID:19429403 A2m Rat perfluorooctanoic acid affects expression ISO A2m (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of A2M mRNA CTD PMID:19429403 A2m Rat perfluorooctanoic acid decreases expression ISO A2M (Homo sapiens) 6480464 perfluorooctanoic acid results in decreased expression of A2M mRNA CTD PMID:36251517 A2m Rat perfluoroundecanoic acid decreases expression ISO A2m (Mus musculus) 6480464 perfluoroundecanoic acid results in decreased expression of A2M mRNA CTD PMID:23567314 A2m Rat phenethyl caffeate multiple interactions EXP 6480464 caffeic acid phenethyl ester inhibits the reaction [Diethylnitrosamine results in decreased expression of A2M mRNA] CTD PMID:20360939 A2m Rat phenformin decreases expression EXP 6480464 Phenformin results in decreased expression of A2M mRNA CTD PMID:31324951 A2m Rat phenobarbital multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in increased expression of A2M mRNA more ... CTD PMID:20935162 and PMID:25374375 A2m Rat phenobarbital affects expression ISO A2M (Homo sapiens) 6480464 Phenobarbital affects the expression of A2M mRNA CTD PMID:19159669 A2m Rat phenobarbital decreases expression EXP 6480464 Phenobarbital results in decreased expression of A2M mRNA CTD PMID:19162173 A2m Rat phenylmercury acetate increases expression ISO A2M (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of A2M mRNA CTD PMID:26272509 A2m Rat phenylmercury acetate multiple interactions ISO A2M (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of A2M mRNA CTD PMID:27188386 A2m Rat PhIP increases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in increased expression of A2M mRNA CTD PMID:15059925 A2m Rat phorbol 13-acetate 12-myristate increases expression EXP 6480464 Tetradecanoylphorbol Acetate results in increased expression of A2M mRNA CTD PMID:2440878 A2m Rat pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of A2M mRNA CTD PMID:16940010 A2m Rat pirinixic acid multiple interactions ISO A2m (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of A2M mRNA CTD PMID:19710929 A2m Rat potassium bromate decreases expression ISO A2M (Homo sapiens) 6480464 potassium bromate results in decreased expression of A2M mRNA CTD PMID:30008028 A2m Rat prednisone decreases expression ISO A2M (Homo sapiens) 6480464 Prednisone results in decreased expression of A2M protein CTD PMID:11304663 A2m Rat progesterone affects expression ISO A2m (Mus musculus) 6480464 Progesterone affects the expression of A2M mRNA CTD PMID:17251523 A2m Rat progesterone decreases expression ISO A2m (Mus musculus) 6480464 Progesterone results in decreased expression of A2M mRNA CTD PMID:22238285 A2m Rat propanal increases expression ISO A2M (Homo sapiens) 6480464 propionaldehyde results in increased expression of A2M mRNA CTD PMID:26079696 A2m Rat pyrethrins decreases expression EXP 6480464 Pyrethrins results in decreased expression of A2M protein CTD PMID:34896426 A2m Rat pyrogallol multiple interactions ISO A2m (Mus musculus) 6480464 Silymarin inhibits the reaction [Pyrogallol results in increased expression of A2M mRNA] CTD PMID:20362636 A2m Rat pyrogallol increases expression ISO A2m (Mus musculus) 6480464 Pyrogallol results in increased expression of A2M mRNA CTD PMID:20362636 A2m Rat rac-lactic acid multiple interactions ISO A2M (Homo sapiens) 6480464 HSPA5 protein affects the reaction [A2M protein modified form results in increased secretion of Lactic Acid] CTD PMID:25720493 A2m Rat rac-lactic acid increases secretion ISO A2M (Homo sapiens) 6480464 A2M protein modified form results in increased secretion of Lactic Acid CTD PMID:25720493 A2m Rat SB 431542 multiple interactions ISO A2M (Homo sapiens) 6480464 [LDN 193189 co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 and PMID:34480604 A2m Rat selenium atom increases expression ISO A2M (Homo sapiens) 6480464 Selenium results in increased expression of A2M mRNA CTD PMID:18997278 A2m Rat selenium atom multiple interactions ISO A2M (Homo sapiens) 6480464 Selenium inhibits the reaction [T-2 Toxin results in decreased expression of A2M mRNA] and Selenium promotes the reaction [T-2 Toxin results in decreased expression of A2M protein] CTD PMID:21144892 A2m Rat silicon dioxide increases expression ISO A2M (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of A2M mRNA CTD PMID:23806026 A2m Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of A2M mRNA CTD PMID:34779285 A2m Rat silicon dioxide increases expression ISO A2m (Mus musculus) 6480464 Silicon Dioxide results in increased expression of A2M mRNA CTD PMID:23221170 A2m Rat simvastatin decreases expression EXP 6480464 Simvastatin results in decreased expression of A2M mRNA CTD PMID:16414398 A2m Rat sirolimus increases expression EXP 6480464 Sirolimus results in increased expression of A2M mRNA CTD PMID:21865292 A2m Rat sodium arsenite increases expression ISO A2m (Mus musculus) 6480464 sodium arsenite results in increased expression of A2M mRNA CTD PMID:16014739 A2m Rat sodium arsenite decreases expression ISO A2m (Mus musculus) 6480464 sodium arsenite results in decreased expression of A2M mRNA CTD PMID:37682722 A2m Rat sodium arsenite decreases expression ISO A2M (Homo sapiens) 6480464 sodium arsenite results in decreased expression of A2M mRNA CTD PMID:29301061 A2m Rat sodium dichromate affects expression EXP 6480464 sodium bichromate affects the expression of A2M mRNA CTD PMID:22110744 A2m Rat sodium dichromate increases expression EXP 6480464 sodium bichromate results in increased expression of A2M mRNA CTD PMID:25993096 A2m Rat Soman increases expression EXP 6480464 Soman results in increased expression of A2M mRNA CTD PMID:19281266 A2m Rat streptozocin multiple interactions ISO A2m (Mus musculus) 6480464 [Streptozocin co-treated with Dietary Fats] results in increased expression of A2M mRNA and Diethylhexyl Phthalate inhibits the reaction [[Streptozocin co-treated with Dietary Fats] results in increased expression of A2M mRNA] CTD PMID:33484791 A2m Rat sulforaphane decreases expression ISO A2M (Homo sapiens) 6480464 sulforaphane results in decreased expression of A2M mRNA CTD PMID:31838189 A2m Rat sunitinib decreases expression ISO A2M (Homo sapiens) 6480464 Sunitinib results in decreased expression of A2M mRNA CTD PMID:31533062 A2m Rat T-2 toxin multiple interactions ISO A2M (Homo sapiens) 6480464 Selenium inhibits the reaction [T-2 Toxin results in decreased expression of A2M mRNA] and Selenium promotes the reaction [T-2 Toxin results in decreased expression of A2M protein] CTD PMID:21144892 A2m Rat T-2 toxin decreases expression ISO A2M (Homo sapiens) 6480464 T-2 Toxin results in decreased expression of A2M mRNA and T-2 Toxin results in decreased expression of A2M protein CTD PMID:21144892 A2m Rat tacrolimus hydrate increases expression EXP 6480464 Tacrolimus results in increased expression of A2M mRNA CTD PMID:21865292 A2m Rat tauroursodeoxycholic acid decreases expression EXP 6480464 ursodoxicoltaurine results in decreased expression of A2M mRNA CTD PMID:15885361 A2m Rat testosterone multiple interactions EXP 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of A2M mRNA CTD PMID:32741896 A2m Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of A2M mRNA CTD PMID:31150632 A2m Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of A2M mRNA] CTD PMID:31150632 A2m Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of A2M mRNA CTD PMID:16297948 and PMID:23411599 A2m Rat thioacetamide multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in increased expression of A2M mRNA CTD PMID:28943392 A2m Rat trichloroethene increases methylation EXP 6480464 Trichloroethylene results in increased methylation of A2M gene CTD PMID:27618143 A2m Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of A2M mRNA CTD PMID:33387578 A2m Rat trichostatin A increases expression ISO A2M (Homo sapiens) 6480464 trichostatin A results in increased expression of A2M mRNA CTD PMID:24935251 A2m Rat triclosan decreases expression ISO A2M (Homo sapiens) 6480464 Triclosan results in decreased expression of A2M mRNA CTD PMID:30510588 A2m Rat triphenyl phosphate affects expression ISO A2M (Homo sapiens) 6480464 triphenyl phosphate affects the expression of A2M mRNA CTD PMID:37042841 A2m Rat triptonide increases expression ISO A2m (Mus musculus) 6480464 triptonide results in increased expression of A2M mRNA CTD PMID:33045310 A2m Rat tris(2-butoxyethyl) phosphate affects expression ISO A2M (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate affects the expression of A2M mRNA CTD PMID:29024780 A2m Rat valproic acid decreases expression ISO A2M (Homo sapiens) 6480464 Valproic Acid results in decreased expression of A2M mRNA CTD PMID:29154799 and PMID:29501571 A2m Rat valproic acid increases expression ISO A2M (Homo sapiens) 6480464 Valproic Acid results in increased expression of A2M mRNA CTD PMID:28001369 A2m Rat valproic acid affects expression ISO A2M (Homo sapiens) 6480464 Valproic Acid affects the expression of A2M mRNA CTD PMID:25979313 A2m Rat valproic acid decreases methylation ISO A2M (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of A2M gene CTD PMID:29154799 A2m Rat vancomycin increases expression EXP 6480464 Vancomycin results in increased expression of A2M mRNA CTD PMID:18289764 A2m Rat vinclozolin increases expression EXP 6480464 vinclozolin results in increased expression of A2M mRNA CTD PMID:22570695 A2m Rat XAV939 multiple interactions ISO A2M (Homo sapiens) 6480464 [[ascorbate-2-phosphate co-treated with Chir 99021 co-treated with XAV939 co-treated with BMP4 protein] co-treated with [INHBA protein binds to INHBA protein]] results in increased expression of A2M mRNA and [[Ascorbic Acid co-treated with Chir 99021 co-treated with XAV939 co-treated with BMP4 protein co-treated with FGF1 protein co-treated with WNT3A protein co-treated with HGF protein] co-treated with [INHBA protein binds to INHBA protein]] results in increased expression of A2M mRNA CTD PMID:34480604 A2m Rat XL147 multiple interactions ISO A2m (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with XL147] results in decreased expression of A2M mRNA CTD PMID:27935865 A2m Rat zinc atom affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Zinc CTD PMID:23896426 A2m Rat zinc(0) affects binding ISO A2M (Homo sapiens) 6480464 A2M protein binds to Zinc CTD PMID:23896426
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(+)-pilocarpine (EXP) (+)-schisandrin B (EXP) (S)-amphetamine (EXP) 1-methylphenanthrene (ISO) 1-naphthyl isothiocyanate (EXP) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP) 17beta-estradiol 3-benzoate (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-deoxy-D-glucose (ISO) 2-hydroxypropanoic acid (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3H-1,2-dithiole-3-thione (EXP) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (ISO) 6-aminohexanoate (ISO) 6-aminohexanoic acid (ISO) 6-propyl-2-thiouracil (EXP) 7-nitroindazole (EXP) acrylamide (ISO) Actein (EXP) aflatoxin B1 (EXP,ISO) aldehydo-D-glucose (ISO) all-trans-retinoic acid (ISO) allethrin (EXP) allopurinol (EXP) ammonium chloride (EXP) antimony(0) (ISO) apigenin (EXP) arotinoid acid (ISO) arsenous acid (ISO) bacitracin (EXP) benzo[a]pyrene (ISO) beta-naphthoflavone (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) cadmium atom (ISO) cadmium dichloride (EXP,ISO) carbon nanotube (ISO) carbonyl sulfide (EXP) carnosic acid (ISO) CHIR 99021 (ISO) chlorohydrocarbon (EXP) chlorpyrifos (ISO) cholate (EXP) cisplatin (EXP,ISO) clofibrate (EXP) clofibric acid (EXP) copper atom (EXP,ISO) copper(0) (EXP,ISO) copper(II) sulfate (ISO) corosolic acid (ISO) corticosterone (EXP) cortisol (ISO) Cuprizon (EXP) cyclosporin A (EXP,ISO) cyhalothrin (EXP) cypermethrin (EXP) D-glucose (ISO) dexamethasone (EXP,ISO) diarsenic trioxide (ISO) dibenz[a,h]anthracene (ISO) dibenzo[a,l]pyrene (ISO) dichloroacetic acid (ISO) diclofenac (ISO) dimethyl sulfoxide (EXP) dimethylarsinic acid (EXP) dioxygen (EXP) dipotassium bis[mu-tartrato(4-)]diantimonate(2-) trihydrate (ISO) diuron (ISO) dorsomorphin (ISO) doxorubicin (ISO) elemental selenium (ISO) endosulfan (EXP) fenvalerate (EXP) fluoranthene (ISO) flutamide (EXP) fructose (ISO) furan (EXP) gemcitabine (ISO) genistein (ISO) gentamycin (EXP) glafenine (EXP) glucose (ISO) glycidyl methacrylate (ISO) indole-3-methanol (EXP) indometacin (ISO) irinotecan (EXP) isoniazide (EXP) isoprenaline (ISO) isotretinoin (ISO) ketoconazole (EXP) L-ascorbic acid (ISO) L-ascorbic acid 2-phosphate (ISO) lead diacetate (EXP) lead(0) (ISO) lipopolysaccharide (EXP,ISO) melamine (EXP) menadione (ISO) mercury atom (ISO) mercury dichloride (ISO) mercury(0) (ISO) methapyrilene (EXP) methylmercury chloride (EXP) mono(2-ethylhexyl) phthalate (EXP,ISO) N(6),N(6)-dimethyladenine (EXP) N-nitrosodiethylamine (EXP) N-nitrosodimethylamine (EXP,ISO) naphthalene (EXP,ISO) nickel atom (ISO) nitrofen (EXP) obeticholic acid (ISO) ochratoxin A (EXP,ISO) olanzapine (ISO) orphenadrine (EXP) ouabain (ISO) ozone (EXP,ISO) paracetamol (EXP) perfluorobutyric acid (ISO) perfluorodecanoic acid (ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) perfluoroundecanoic acid (ISO) phenethyl caffeate (EXP) phenformin (EXP) phenobarbital (EXP,ISO) phenylmercury acetate (ISO) PhIP (EXP) phorbol 13-acetate 12-myristate (EXP) pirinixic acid (EXP,ISO) potassium bromate (ISO) prednisone (ISO) progesterone (ISO) propanal (ISO) pyrethrins (EXP) pyrogallol (ISO) rac-lactic acid (ISO) SB 431542 (ISO) selenium atom (ISO) silicon dioxide (EXP,ISO) simvastatin (EXP) sirolimus (EXP) sodium arsenite (ISO) sodium dichromate (EXP) Soman (EXP) streptozocin (ISO) sulforaphane (ISO) sunitinib (ISO) T-2 toxin (ISO) tacrolimus hydrate (EXP) tauroursodeoxycholic acid (EXP) testosterone (EXP) tetrachloromethane (EXP) thioacetamide (EXP) trichloroethene (EXP) trichostatin A (ISO) triclosan (ISO) triphenyl phosphate (ISO) triptonide (ISO) tris(2-butoxyethyl) phosphate (ISO) valproic acid (ISO) vancomycin (EXP) vinclozolin (EXP) XAV939 (ISO) XL147 (ISO) zinc atom (ISO) zinc(0) (ISO)
1.
Role of prostaglandins in acute phase proteins in inflammation.
Anbalagan K and Sadique J, Biochem Med. 1984 Apr;31(2):236-45.
2.
Intrahepatic STAT-3 activation and acute phase gene expression predict outcome after CLP sepsis in the rat.
Andrejko KM, etal., Am J Physiol. 1998 Dec;275(6 Pt 1):G1423-9.
3.
Carbon dioxide pneumoperitoneum alters acute-phase response induced by lipopolysaccharide.
Are C, etal., Surg Endosc. 2002 Oct;16(10):1464-7. Epub 2002 Jun 4.
4.
The genetic association database.
Becker KG, etal., Nat Genet. 2004 May;36(5):431-2.
5.
Cancer-related anemia in a rat model: alpha2-macroglobulin from Yoshida sarcoma shortens erythrocyte survival.
Bhanushali AA, etal., Eur J Haematol 2002 Jan;68(1):42-8.
6.
Alpha-2 macroglobulin is genetically associated with Alzheimer disease.
Blacker D, etal., Nat Genet 1998 Aug;19(4):357-60.
7.
Alpha 2 macroglobulin activity in rats infected with Typanosoma lewisi and treated with cyclophosphamide and its effect on the malignancy of the disease.
Budovsky A, etal., J Vector Borne Dis. 2007 Jun;44(2):128-36.
8.
Association of alpha 2-macroglobulin polymorphisms and Alzheimer disease in Mainland Han Chinese.
Chen D, etal., J Neurol Sci. 2004 Jan 15;217(1):13-5.
9.
Gene expression profiles of livers from thermally injured rats.
Dasu MR, etal., Gene. 2004 Feb 18;327(1):51-60.
10.
Alpha-2 macroglobulin polymorphism and Alzheimer disease risk in the UK.
Dow DJ, etal., Nat Genet 1999 May;22(1):16-7; author reply 21-2.
11.
The development of rat alpha 2-macroglobulin. Studies in vivo and in cultured fetal rat hepatocytes.
Fletcher S, etal., Eur J Biochem. 1988 Feb 1;171(3):703-9.
12.
Hormonal regulation and tissue-specific localization of alpha 2-macroglobulin in rat ovarian follicles and corpora lutea.
Gaddy-Kurten D, etal., Endocrinology. 1989 Dec;125(6):2985-95.
13.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
14.
Alpha 2-macroglobulin synthesis in an astrocyte subpopulation.
Gebicke-Haerter PJ, etal., J Neurochem. 1987 Oct;49(4):1139-45.
15.
Sequence of rat liver alpha 2-macroglobulin and acute phase control of its messenger RNA.
Gehring MR, etal., J Biol Chem 1987 Jan 5;262(1):446-54.
16.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
17.
Inflammatory and metalloproteinases profiles predict three-month poor outcomes in ischemic stroke treated with thrombolysis.
Gori AM, etal., J Cereb Blood Flow Metab. 2017 Sep;37(9):3253-3261. doi: 10.1177/0271678X17695572. Epub 2017 Mar 7.
18.
6-sulphanilamidoindazole arthritis of rats: relation between acute-phase proteins, degree of arthritis and treatment with soybean trypsin inhibitor.
Hirschelmann R, etal., Agents Actions. 1980 Nov;10(5):431-4.
19.
Isolation of bona fide differentially expressed genes in the 18-hour sepsis liver by suppression subtractive hybridization.
Hsieh YC, etal., Shock. 2004 Jun;21(6):549-55.
20.
Disorders of vesicles of lysosomal lineage: the Hermansky-Pudlak syndromes.
Huizing M and Gahl WA, Curr Mol Med. 2002 Aug;2(5):451-67.
21.
Suppression of experimental allergic encephalomyelitis by alpha 2-macroglobulin.
Hunter N, etal., Immunology. 1991 May;73(1):58-63.
22.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
23.
Anti-tumor activity of the TRA-8 anti-DR5 antibody in combination with cisplatin in an ex vivo human cervical cancer model.
Kendrick JE, etal., Gynecol Oncol. 2008 Mar;108(3):591-7. Epub 2008 Jan 4.
24.
New insights into the pathogenesis of glucocorticoid-induced avascular necrosis: microarray analysis of gene expression in a rat model.
Kerachian MA, etal., Arthritis Res Ther. 2010;12(3):R124. doi: 10.1186/ar3062. Epub 2010 Jun 25.
25.
Kupffer cell stimulation of alpha 2-macroglobulin synthesis in rat hepatocytes and the role of glucocorticoid.
Kurokawa S, etal., Cell Struct Funct. 1987 Feb;12(1):35-42.
26.
Ontology searching and browsing at the Rat Genome Database.
Laulederkind SJ, etal., Database (Oxford). 2012 Mar 20;2012:bas016. Print 2012.
27.
Induction and modulation of acute-phase response by protein malnutrition in rats: comparative effect of systemic and localized inflammation on interleukin-6 and acute-phase protein synthesis.
Lyoumi S, etal., J Nutr. 1998 Feb;128(2):166-74.
28.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
29.
The kallikrein-kinin system: current and future pharmacological targets.
Moreau ME, etal., J Pharmacol Sci. 2005 Sep;99(1):6-38.
30.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
31.
Purification and properties of rat alpha 2 acute-phase macroglobulin.
Nieuwenhuizen W, etal., Biochim Biophys Acta. 1979 Sep 29;580(1):129-39.
32.
Structure and acute-phase regulation of the rat alpha 2-macroglobulin gene.
Northemann W, etal., Biochemistry 1988 Dec 27;27(26):9194-203.
33.
Molecular cloning of cDNA sequences for rat alpha 2-macroglobulin and measurement of its transcription during experimental inflammation.
Northemann W, etal., J Biol Chem 1985 May 25;260(10):6200-5.
34.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
35.
The Rat Genome Database pathway portal.
Petri V, etal., Database (Oxford). 2011 Apr 8;2011:bar010. Print 2011.
36.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
37.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
38.
Detection of an alteration of the alpha 2-macroglobulin gene in a patient with chronic lung disease and serum alpha 2-macroglobulin deficiency.
Poller W, etal., Hum Genet 1989 Aug;83(1):93-6.
39.
alpha 2-Macroglobulin exposure reduces calcium responses to N-methyl-D-aspartate via low density lipoprotein receptor-related protein in cultured hippocampal neurons.
Qiu Z, etal., J Biol Chem 2002 Apr 26;277(17):14458-66.
40.
Direct injection and expression in vivo of full-length cDNA of the cardiac isoform of alpha-2 macroglobulin induces cardiac hypertrophy in the rat heart.
Rajan S, etal., Basic Res Cardiol 2003 Feb;98(1):39-49.
41.
Immune complement and coagulation dysfunction in adverse outcomes of SARS-CoV-2 infection.
Ramlall V, etal., Nat Med. 2020 Aug 3. pii: 10.1038/s41591-020-1021-2. doi: 10.1038/s41591-020-1021-2.
42.
GOA pipeline
RGD automated data pipeline
43.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
44.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
45.
Comprehensive gene review and curation
RGD comprehensive gene curation
46.
Genetic association of Alzheimer's disease with multiple polymorphisms in alpha-2-macroglobulin.
Saunders AJ, etal., Hum Mol Genet. 2003 Nov 1;12(21):2765-76. Epub 2003 Sep 9.
47.
No association of three polymorphisms in the alpha-2-macroglobulin and lipoprotein related receptor genes with multiple sclerosis.
Schweer D, etal., J Neuroimmunol 2001 Aug 30;118(2):300-3.
48.
Mechanisms of TGF-beta signaling from cell membrane to the nucleus.
Shi Y and Massague J, Cell. 2003 Jun 13;113(6):685-700.
49.
No genetic association between alpha-2 macroglobulin I1000V polymorphism and Japanese sporadic Alzheimer's disease.
Shibata N, etal., Neurosci Lett. 2000 Aug 25;290(2):154-6.
50.
Transplacental transport of alpha 2-macroglobulin (alpha 2M) and induction of alpha 2M in maternal and neonatal rats with acute inflammation.
Shimizu M, etal., Exp Anim. 2002 Jul;51(4):361-5.
51.
Comparative binding of biotinylated neurotrophins to alpha(2)-macroglobulin family of proteins: relationship between cytokine-binding and neuro-modulatory activities of the macroglobulins.
Skornicka EL, etal., J Neurosci Res. 2002 Feb 1;67(3):346-53.
52.
Beneficial effects of Psidium guajava leaf extract on diabetic myocardium.
Soman S, etal., Exp Toxicol Pathol. 2013 Jan;65(1-2):91-5. doi: 10.1016/j.etp.2011.06.005. Epub 2011 Jul 13.
53.
Role of nitric oxide in the regulation of activity of proteinase inhibitors alpha(1)-antitrypsin and alpha(2)-macroglobulin by capsaicin-sensitive nerves.
Spiridonov VK and Tolochko ZS, Bull Exp Biol Med. 2008 Sep;146(3):375-8.
54.
Serum alpha 2-macroglobulin and alpha 1-inhibitor 3 concentrations are increased in hypoalbuminemia by post-transcriptional mechanisms.
Stevenson FT, etal., Kidney Int. 1998 Jan;53(1):67-75.
55.
Cardiac isoform of alpha 2 macroglobulin and its reliability as a cardiac marker in HIV patients.
Subbiah R, etal., Heart Lung Circ. 2010 Feb;19(2):93-5. doi: 10.1016/j.hlc.2009.10.005. Epub 2009 Dec 11.
56.
alpha(2)-Macroglobulin: a novel cytochemical marker characterizing preneoplastic and neoplastic rat liver lesions negative for hitherto established cytochemical markers.
Sukata T, etal., Am J Pathol 2004 Nov;165(5):1479-88.
57.
Alpha-2 macroglobulin I1000 V polymorphism in Chinese sporadic Alzheimer's disease and Parkinson's disease.
Tang G, etal., Neurosci Lett. 2002 Aug 9;328(2):195-7.
58.
Tentative Sequence Identification Numbers
Tentative Sequence Data IDs. TIGR Gene Index, Rat Data
59.
Sequence analysis of the putative regulatory region of rat alpha 2-macroglobulin gene.
Tsuchiya Y, etal., Gene 1987;57(1):73-80.
60.
Messenger RNA profiles in liver injury and stress: a comparison of lethal and nonlethal rat models.
Tygstrup N, etal., Biochem Biophys Res Commun 2002 Jan 11;290(1):518-25.
61.
Alpha 2 macroglobulin of the rat, an acute phase protein, mitigates the early course of endotoxin shock.
van Vugt H, etal., Br J Exp Pathol. 1986 Jun;67(3):313-9.
62.
Fever and acute phase reactants in the rat.
van Vugt H, etal., Br J Exp Pathol. 1988 Aug;69(4):577-88.
63.
Alpha-2-macroglobulin and albumin are useful serum proteins to detect subclinical peritonitis in the rat.
van Westrhenen R, etal., Perit Dial Int. 2006 Jan-Feb;26(1):101-7.
64.
Improvement of visual acuity in patients suffering from diabetic retinopathy after membrane differential filtration: a pilot study.
Widder RA, etal., Transfus Sci. 1999 Dec;21(3):201-6.
A2m Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 156,570,163 - 156,619,870 (+) NCBI GRCr8 mRatBN7.2 4 154,897,770 - 154,947,787 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 154,897,877 - 154,947,786 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 161,158,697 - 161,208,341 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 156,942,158 - 156,991,802 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 155,571,666 - 155,634,340 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 154,309,426 - 154,359,138 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 154,309,426 - 154,359,137 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 154,423,209 - 154,472,924 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 221,393,233 - 221,442,945 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 158,103,711 - 158,153,423 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 158,348,624 - 158,398,358 (+) NCBI Celera 4 143,730,195 - 143,781,190 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
A2M Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 9,067,708 - 9,116,229 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 9,067,664 - 9,116,229 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 9,220,304 - 9,268,825 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 9,111,571 - 9,159,825 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 9,111,576 - 9,159,754 NCBI Celera 12 10,757,430 - 10,805,676 (-) NCBI Celera Cytogenetic Map 12 p13.31 NCBI HuRef 12 9,000,837 - 9,049,088 (-) NCBI HuRef CHM1_1 12 9,189,284 - 9,237,532 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 9,049,893 - 9,098,416 (-) NCBI T2T-CHM13v2.0
A2m Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 121,612,920 - 121,656,197 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 121,612,335 - 121,656,186 (+) Ensembl GRCm39 Ensembl GRCm38 6 121,636,165 - 121,679,238 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 121,635,376 - 121,679,227 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 121,586,191 - 121,629,256 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 121,593,574 - 121,644,846 (+) NCBI MGSCv36 mm8 MGSCv36 6 122,445,338 - 122,497,328 (+) NCBI MGSCv36 mm8 Celera 6 123,474,284 - 123,517,770 (+) NCBI Celera Cytogenetic Map 6 F1 NCBI cM Map 6 57.49 NCBI
LOC102021956 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 6,019,082 - 6,062,529 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 6,019,457 - 6,062,366 (+) NCBI ChiLan1.0 ChiLan1.0
LOC100979269 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 14,596,200 - 14,644,826 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 14,592,959 - 14,641,585 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 9,154,457 - 9,202,833 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 9,385,359 - 9,434,011 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 9,385,359 - 9,433,979 (-) Ensembl panpan1.1 panPan2
A2M Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 36,654,328 - 36,695,775 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 9,920,641 - 9,962,291 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 37,002,478 - 37,044,674 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 37,002,374 - 37,044,672 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 36,883,699 - 36,925,608 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 36,918,717 - 36,960,000 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 9,452,043 - 9,493,920 (-) NCBI UU_Cfam_GSD_1.0
LOC101959212
A2M Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 62,440,810 - 62,483,678 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 62,406,928 - 62,483,690 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 65,274,903 - 65,320,342 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Predicted Target Of
Count of predictions: 28 Count of miRNA genes: 27 Interacting mature miRNAs: 27 Transcripts: ENSRNOT00000019346 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 61446 Coreg2 Compensatory renal growth QTL 2 3.5 kidney mass (VT:0002707) compensatory renal growth score (CMO:0001894) 4 148423102 157580971 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 6478763 Anxrr46 Anxiety related response QTL 46 0.07428 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 6478760 Anxrr45 Anxiety related response QTL 45 0.06717 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331802 Srn5 Serum renin concentration QTL 5 3.045 renin activity (VT:0005581) plasma renin activity level (CMO:0000116) 4 119428175 157578333 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1581574 Eae20 Experimental allergic encephalomyelitis QTL 20 7.8 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 153031106 158841762 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
D4Mit20
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 154,902,669 - 154,902,892 (+) MAPPER mRatBN7.2 Rnor_6.0 4 154,314,020 - 154,314,242 NCBI Rnor6.0 Rnor_6.0 4 154,427,762 - 154,427,984 NCBI Rnor6.0 Rnor_5.0 4 221,510,881 - 221,511,103 UniSTS Rnor5.0 Rnor_5.0 4 221,397,827 - 221,398,049 UniSTS Rnor5.0 RGSC_v3.4 4 158,108,304 - 158,108,528 RGD RGSC3.4 RGSC_v3.4 4 158,108,305 - 158,108,527 UniSTS RGSC3.4 RGSC_v3.1 4 158,353,240 - 158,353,464 RGD Celera 4 143,736,074 - 143,736,296 UniSTS Celera 4 143,734,692 - 143,736,296 UniSTS RH 3.4 Map 4 997.54 RGD RH 3.4 Map 4 997.54 UniSTS RH 2.0 Map 4 1012.9 RGD Cytogenetic Map 4 q42 UniSTS
D4Wox16
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 156,568,282 - 156,568,425 (+) Marker Load Pipeline mRatBN7.2 4 154,896,195 - 154,896,338 (+) MAPPER mRatBN7.2 Rnor_6.0 4 154,307,546 - 154,307,688 NCBI Rnor6.0 Rnor_6.0 4 154,421,288 - 154,421,430 NCBI Rnor6.0 Rnor_5.0 4 221,504,407 - 221,504,549 UniSTS Rnor5.0 Rnor_5.0 4 221,391,353 - 221,391,495 UniSTS Rnor5.0 RGSC_v3.4 4 158,101,831 - 158,101,973 UniSTS RGSC3.4 RGSC_v3.4 4 158,101,830 - 158,101,973 RGD RGSC3.4 RGSC_v3.1 4 158,346,766 - 158,346,909 RGD Celera 4 143,728,315 - 143,728,457 UniSTS RH 3.4 Map 4 997.91 RGD RH 3.4 Map 4 997.91 UniSTS Cytogenetic Map 4 q42 UniSTS
D4Arb15
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 154,896,113 - 154,896,328 (+) MAPPER mRatBN7.2 Rnor_6.0 4 154,307,464 - 154,307,678 NCBI Rnor6.0 Rnor_6.0 4 154,421,206 - 154,421,420 NCBI Rnor6.0 Rnor_5.0 4 221,391,271 - 221,391,485 UniSTS Rnor5.0 Rnor_5.0 4 221,504,325 - 221,504,539 UniSTS Rnor5.0 RGSC_v3.4 4 158,101,748 - 158,101,963 RGD RGSC3.4 RGSC_v3.4 4 158,101,749 - 158,101,963 UniSTS RGSC3.4 RGSC_v3.1 4 158,346,684 - 158,346,899 RGD Celera 4 143,728,233 - 143,728,447 UniSTS RH 3.4 Map 4 997.5 UniSTS RH 3.4 Map 4 997.5 RGD RH 2.0 Map 4 989.4 RGD SHRSP x BN Map 4 75.9499 RGD Cytogenetic Map 4 q42 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
14
1
12
138
105
95
63
26
63
12
169
66
108
25
78
32
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000019346 ⟹ ENSRNOP00000019346
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 154,897,877 - 154,947,786 (+) Ensembl Rnor_6.0 Ensembl 4 154,309,426 - 154,359,137 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000075799 ⟹ ENSRNOP00000066130
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 154,899,373 - 154,945,739 (+) Ensembl Rnor_6.0 Ensembl 4 154,423,209 - 154,472,924 (+) Ensembl
RefSeq Acc Id:
NM_012488 ⟹ NP_036620
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 156,570,163 - 156,619,870 (+) NCBI mRatBN7.2 4 154,898,076 - 154,947,787 (+) NCBI Rnor_6.0 4 154,309,426 - 154,359,138 (+) NCBI Rnor_5.0 4 221,393,233 - 221,442,945 (+) NCBI RGSC_v3.4 4 158,103,711 - 158,153,423 (+) RGD Celera 4 143,730,195 - 143,781,190 (+) RGD
Sequence:
GTAGGGTGCAAGGCAGCCAGGTCTCCGATCCTTTCCGCAGCATGGGGAAGCACAGGCTCCGGAGCCTGGCCCTGCTGCCACTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCCCACCGATGCCTCAGCT
hide sequence
RefSeq Acc Id:
NP_036620 ⟸ NM_012488
- Peptide Label:
precursor
- UniProtKB:
Q4FZY3 (UniProtKB/Swiss-Prot), P06238 (UniProtKB/Swiss-Prot), A6ILD0 (UniProtKB/TrEMBL)
- Sequence:
MGKHRLRSLALLPLLLRLLLLLLPTDASAPQKPIYMVMVPSLLHAGTPEKACFLFSHLNETVAVRVSLESVRGNQSLFTDLVVDKDLFHCTSFTVPQSSSDEVMFFTVQVKGATHEFRRRSTVLVKKK
hide sequence
Ensembl Acc Id:
ENSRNOP00000019346 ⟸ ENSRNOT00000019346
Ensembl Acc Id:
ENSRNOP00000066130 ⟸ ENSRNOT00000075799
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
A2m
alpha-2-macroglobulin
LOC100911545
alpha-2-macroglobulin-like
Data merged from RGD:6492449
737654 PROVISIONAL
2012-07-05
LOC100911545
alpha-2-macroglobulin-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2006-11-16
A2m
A2m1
alpha-2-macroglobulin
Symbol updated to reflect Human and Mouse nomenclature
1299863 APPROVED
2002-06-10
A2m
alpha-2-macroglobulin
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
may be induced during the regeneration of hepatocytes after liver damage
67925
gene_expression
may be induced during the regeneration of hepatocytes after liver damage
70249
gene_process
has a role in the acute-phase response to tissue damage and infection
67925
gene_process
has a role in the acute-phase response to tissue damage and infection
70249
gene_process
inhibits proteinases
67925
gene_process
inhibits proteinases
70249
