D13Got68 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D13Got68

Symbol: D13Got68
Also known as: OT92.08; oxsts994; 
RGD ID: 625775
Expected Size: 166 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01386,290,553 - 86,290,716NCBIRnor6.0
Rnor_5.01390,929,315 - 90,929,478UniSTSRnor5.0
RGSC_v3.41383,739,530 - 83,739,847RGDRGSC3.4
RGSC_v3.41383,739,577 - 83,739,740UniSTSRGSC3.4
RGSC_v3.11383,753,765 - 83,753,928RGD
Celera1379,915,234 - 79,915,397UniSTS
RH 3.4 Map13538.9RGD
RH 3.4 Map13538.9UniSTS


Annotation



Strains and Sequence

Sequence
 
Forward Primer CATACCGGCACATGTATCCA
Reverse Primer CAGCTGCCTGTGGTATTGTATT
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133950130093652524Rat
4889861Pur29Proteinuria QTL 2913.80.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)134231074486833540Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)134231074487310744Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)134357571788575717Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134567662990676629Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135108098996080989Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135156924896569248Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)135157782490675199Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1357903612102903612Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1362975663107975663Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)136500824591629354Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1366971778111971778Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1371230858114033958Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1371230858114033958Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1372583716114033958Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)137456837892916783Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)137456837892916783Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)137456837892916783Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)777694986114033958Rat
11530006Niddm72Non-insulin dependent diabetes mellitus QTL 720.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)137956708186833540Rat
8655959Pur32Proteinuria QTL 328.4total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1379567081103613733Rat
738027Lnnr6Liver neoplastic nodule remodeling QTL 63.3liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)138040355991629354Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1380403559108770687Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112762 UniSTS