D14Got44 Marker Search Result - Rat Genome Database

D14Got44 Marker Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

General

Marker: D14Got44

Symbol:

D14Got44

Previously known as:

OT21.15; oxsts1050;

RGD ID:

60063

Expected Size:

153 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	14	35,442,032 - 35,442,185 (+)	MAPPER	mRatBN7.2
Rnor_6.0	14	38,008,403 - 38,008,555	NCBI	Rnor6.0
Rnor_5.0	14	37,818,685 - 37,818,837	UniSTS	Rnor5.0
RGSC_v3.4	14	37,845,655 - 37,845,808	RGD	RGSC3.4
RGSC_v3.4	14	37,845,656 - 37,845,808	UniSTS	RGSC3.4
RGSC_v3.1	14	37,848,980 - 37,849,133	RGD
Celera	14	34,696,308 - 34,696,463	UniSTS
Cytogenetic Map	14	p11	UniSTS

Is Marker For:

Genes: Tec

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	TAGAGTGTCTGGGACCAGAAGC
Reverse Primer	GGTTCACCAAGTAGGATTTTGG

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
620973	Tec	tec protein tyrosine kinase	14	35352551	35461585	Rat


GenBank Nucleotide	AC095787	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AU027131	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1581500	Renag1	Renal agenesis QTL 1			kidney development trait (VT:0000527)	percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)	14	8170668	68298175	Rat
731183	Pia20	Pristane induced arthritis QTL 20	3.55		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	14	9088978	39057237	Rat
10755459	Coatc15	Coat color QTL 15		0.01681	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	14	19836944	64836944	Rat
1300154	Bp189	Blood pressure QTL 189	3.04		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	14	30883777	68757901	Rat
70187	Pancm5	Pancreatic morphology QTL 5	16.7		pancreas mass (VT:0010144)	pancreas weight to body weight ratio (CMO:0000630)	14	30320092	80829842	Rat
2324617	Coatc2	Coat color QTL 2		0.001	coat/hair pigmentation trait (VT:0010463)	pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)	14	30767025	39153750	Rat
1358296	Ael3	Aortic elastin QTL 3	3.7	0.00051	aorta elastin amount (VT:0003905)	aortic elastin	14	8267090	53267090	Rat
71117	Niddm17	Non-insulin dependent diabetes mellitus QTL 17	2.35		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	14	17593761	42336881	Rat
61420	Pia6	Pristane induced arthritis QTL 6	4.9		joint integrity trait (VT:0010548)	arthritic paw count (CMO:0001460)	14	18631345	42337007	Rat
7387267	Uae42	Urinary albumin excretion QTL 42		0.61	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	14	22167967	67167967	Rat
631839	Niddm37	Non-insulin dependent diabetes mellitus QTL 37	3.37		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	11030622	95876975	Rat
2313397	Coatc1	Coat color QTL1			coat/hair pigmentation trait (VT:0010463)	coat/hair color measurement (CMO:0001808)	14	18541332	63541332	Rat
631262	Tcas4	Tongue tumor susceptibility QTL 4	7.29		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	14	17622561	42337007	Rat
634352	Apr6	Acute phase response QTL 6	3.7		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	14	1	41131407	Rat
2302045	Pia39	Pristane induced arthritis QTL 39	4.9	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G2a level (CMO:0002116)	14	8267090	53267090	Rat

Database	Acc Id	Source(s)
NCBI Gene	84492	UniSTS