UniSTS:266990 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: UniSTS:266990

Symbol: UniSTS:266990
Previously known as:
RGD ID: 5501722
Expected Size: 142 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2543,125,075 - 43,125,217 (+)MAPPERmRatBN7.2
Rnor_6.0543,757,571 - 43,757,712NCBIRnor6.0
Rnor_5.0548,386,410 - 48,386,551UniSTSRnor5.0
RGSC_v3.4544,878,283 - 44,878,424UniSTSRGSC3.4
Celera541,943,655 - 41,943,796UniSTS
Cytogenetic Map5q21UniSTS
Is Marker For: Genes:   Epha7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGCTTAAGACTGCAGGAGAAC
Reverse Primer GGTGGCACTTAGGAGTTCAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
70957Epha7Eph receptor A754297535343128703Rat

Nucleotide Sequences
GenBank Nucleotide FT010107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293666Bmd38Bone mineral density QTL 384.4femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)5894822853948228Rat
1578776Stresp18Stress response QTL 182.9thymus mass (VT:0004954)thymus wet weight (CMO:0000855)52795544072955440Rat
1298067Scl15Serum cholesterol level QTL 154.80.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)53321566578215665Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1358353Srcrtb2Stress Responsive Cort Basal QTL 23.480.003blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)51887394774251464Rat
1300117Hrtrt8Heart rate QTL 83.49heart pumping trait (VT:2000009)heart rate (CMO:0000002)5384401847869213Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
1598807Glom12Glomerulus QTL 122.7kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)53321566578215665Rat
1302786Kidm8Kidney mass QTL 828.15kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)53321566578215665Rat
6903292Stl28Serum triglyceride level QTL 282.60.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)52851548973515489Rat
61462Niddm10Non-insulin dependent diabetes mellitus QTL 103.90.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)5511215947171491Rat
1578767Stresp17Stress response QTL 174.30.01blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)52795544072955440Rat
1549901Neudeg2Neurodegradation QTL 240nervous system integrity trait (VT:0010566)mononuclear cell count (CMO:0002119)52483871044045280Rat
1641922Alcrsp8Alcohol response QTL 8alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)53518915368564008Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
6903306Scl35Serum cholesterol QTL 352.60.0073blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)52851548973515489Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)534730116104251008Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5982326699753708Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
1641903Alcrsp3Alcohol response QTL 3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)51268928557689285Rat
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
8552954Pigfal14Plasma insulin-like growth factor 1 level QTL 149blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)52122674466226744Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)534944474113558310Rat
1600358Mamtr5Mammary tumor resistance QTL 5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51887394763873947Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 171287 UniSTS