RH139439 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH139439

Symbol: RH139439
Previously known as: AW527503; 
RGD ID: 5076892
Expected Size: 245 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21374,939,042 - 74,939,287 (+)MAPPERmRatBN7.2
Rnor_6.01380,479,849 - 80,480,093NCBIRnor6.0
Rnor_5.01385,371,929 - 85,372,173UniSTSRnor5.0
RGSC_v3.41378,266,148 - 78,266,392UniSTSRGSC3.4
Celera1374,689,149 - 74,689,393UniSTS
RH 3.4 Map13456.7UniSTS
Cytogenetic Map13q22UniSTS
Is Marker For: Genes:   Vamp4  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACACTCCAACGACATTCTCCA
Reverse Primer TTCTCACATTGCAGTTGCTTCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309753Vamp4vesicle-associated membrane protein 4137491987274942791Rat

Nucleotide Sequences
GenBank Nucleotide CH473958 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000243 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133466346187525369Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
8655951Rf63Renal function QTL 6312.2blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)136906051977046890Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)136906051986800898Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)134619797684753113Rat
4889861Pur29Proteinuria QTL 2913.80.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)133741558480753406Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)136906051986800898Rat
8655959Pur32Proteinuria QTL 328.4urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)137402391897213863Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)136906051986800898Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133975454484754544Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)133843340883433408Rat
724564Uae11Urinary albumin excretion QTL 115.7urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)135949252277046890Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1366451204106807694Rat
738027Lnnr6Liver neoplastic nodule remodeling QTL 63.3liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)137486211785581182Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)135987440885581182Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133726209282262092Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133741558482415584Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
11530006Niddm72Non-insulin dependent diabetes mellitus QTL 720.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)137402391880753406Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1374862117101339893Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 364033 UniSTS