BI302236 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BI302236

Symbol: BI302236
Previously known as:
RGD ID: 5064518
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2223,805,580 - 23,805,730 (+)MAPPERmRatBN7.2
Rnor_6.0222,154,173 - 22,154,322NCBIRnor6.0
Rnor_5.0241,357,420 - 41,357,569UniSTSRnor5.0
RGSC_v3.4222,818,070 - 22,818,219UniSTSRGSC3.4
Celera219,894,943 - 19,895,092UniSTS
Cytogenetic Map2q12UniSTS
Is Marker For: Genes:   Dhfr  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCATCTAAGCCTTGCTTGGTC
Reverse Primer CCCAAGTCTTAGGCCTGAGGTA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
7387318Stl32Serum triglyceride level QTL 323.20.0003blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)22238462767384627Rat
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)218960362228801039Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24312 UniSTS