BE102735 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: BE102735

Symbol: BE102735
Previously known as:
RGD ID: 5059044
Expected Size: 203 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21182,662,366 - 82,662,570 (+)MAPPERmRatBN7.2
Rnor_6.01186,810,353 - 86,810,556NCBIRnor6.0
Rnor_5.01189,904,291 - 89,904,494UniSTSRnor5.0
RGSC_v3.41184,656,436 - 84,656,639UniSTSRGSC3.4
Celera1181,439,380 - 81,439,583UniSTS
RH 3.4 Map11699.4UniSTS
Cytogenetic Map11q23UniSTS
Is Marker For: Genes:   Tango2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGTCTTCTAGGCCAGGCAGTG
Reverse Primer TGACGTGTAGGCCTCAGAGTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310348Tango2transport and golgi organization 2 homolog118264597882692574Rat

Nucleotide Sequences
GenBank Nucleotide CH473999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)116642214886241447Rat
10450831Scl80Serum cholesterol level QTL 804.70.01blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)117695713183051965Rat
10058954Gmadr7Adrenal mass QTL 72.490.0049adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)116034659086241447Rat
1354656Bvd3Brain ventricular dilatation QTL 33.640.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116944607082846715Rat
1354593Stl12Serum triglyceride level QTL 123.36blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)116642214886241447Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
2302043Pia27Pristane induced arthritis QTL 2718.60.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)118256654583440803Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
4889521Gluco62Glucose level QTL 622.820.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)115513672982993457Rat
7411658Foco27Food consumption QTL 2716.20.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)115635142486241447Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360738 UniSTS