BB181316 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: BB181316

Symbol:

BB181316

Previously known as:

RGD ID:

5051625

Expected Size:

101 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	5	73,642,009 - 73,642,110 (+)	MAPPER	mRatBN7.2
Rnor_6.0	5	75,968,776 - 75,968,876	NCBI	Rnor6.0
Rnor_5.0	5	80,113,913 - 80,114,013	UniSTS	Rnor5.0
RGSC_v3.4	5	76,866,821 - 76,866,921	UniSTS	RGSC3.4
Celera	5	72,465,337 - 72,465,437	UniSTS
Cytogenetic Map	5	q24	UniSTS

Is Marker For:

Genes: Ecpas

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	ATTGGCGGCTTTGTTTTATT
Reverse Primer	CATGATTGTCTTTTGTGGGC

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1306148	Ecpas	Ecm29 proteasome adaptor and scaffold	5	73601745	73714026	Rat


GenBank Nucleotide	BB181316	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1298067	Scl15	Serum cholesterol level QTL 15	4.8	0.001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	33215665	78215665	Rat
1300115	Hrtrt7	Heart rate QTL 7	2.76		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	5	47869062	90099692	Rat
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	68984307	104251008	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	40128307	148607290	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	68984307	104251008	Rat
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	1	131345958	Rat
1358353	Srcrtb2	Stress Responsive Cort Basal QTL 2	3.48	0.003	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	5	18873947	74251464	Rat
634305	Mamtr1	Mammary tumor resistance QTL 1		0.0001	mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	12789751	113558310	Rat
61386	Bp49	Blood pressure QTL 49	16.6		cerebrum integrity trait (VT:0010549)	brain infarction volume (CMO:0001013)	5	60293434	98603051	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	43726656	129132602	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	68984307	104251008	Rat
1598807	Glom12	Glomerulus QTL 12	2.7		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	5	33215665	78215665	Rat
1302786	Kidm8	Kidney mass QTL 8	28.15		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	33215665	78215665	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
7411561	Bw134	Body weight QTL 134	24	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	49463600	94463600	Rat
2303615	Vencon7	Ventilatory control QTL 7		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	5	50983895	95983895	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	50328551	141643988	Rat
1641912	Alcrsp18	Alcohol response QTL 18			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	5	35189153	141643988	Rat
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
1576317	Eutr2	Estrogen induced uterine response QTL 2		0.01	uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	34730116	104251008	Rat
7394712	Emca13	Estrogen-induced mammary cancer QTL 13			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	9823266	99753708	Rat
1331773	Scl26	Serum cholesterol level QTL 26	3.065		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	43726656	86724018	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55805606	132207589	Rat
1331771	Rf35	Renal function QTL 35	4.36965		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	5	729470	86724018	Rat
61359	Eaex	Experimental allergic encephalomyelitis QTL x	3		nervous system integrity trait (VT:0010566)	post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)	5	55715622	100715622	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	31663789	131345958	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	59793399	143070159	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	69540295	151018848	Rat
9589025	Epfw7	Epididymal fat weight QTL 7	20.66	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	5	49463600	94463600	Rat
2303574	Gluco42	Glucose level QTL 42	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	53496719	98496719	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	64719390	109719390	Rat
1331756	Rf34	Renal function QTL 34	4.16275		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	5	1	90450412	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	66174080	124160948	Rat
2316954	Rf57	Renal function QTL 57	0		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	5	59793528	90450144	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	58829236	128034027	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	34944474	113558310	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	68984307	104251008	Rat
2316957	Pur21	Proteinuria QTL 21	6.2		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	5	59793528	113558156	Rat

Database	Acc Id	Source(s)
NCBI Gene	313196	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: BB181316