RH133758 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133758

Symbol: RH133758
Previously known as:
RGD ID: 5049920
Expected Size: 181 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21441,158,440 - 41,158,621 (+)MAPPERmRatBN7.2
Rnor_6.01442,805,924 - 42,806,104NCBIRnor6.0
Rnor_5.01442,604,687 - 42,604,867UniSTSRnor5.0
RGSC_v3.41443,768,803 - 43,768,983UniSTSRGSC3.4
Celera1440,313,187 - 40,313,367UniSTS
Cytogenetic Map14p11UniSTS
Is Marker For: Genes:   Limch1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATGATGTGGTCAGACACCTGG
Reverse Primer TGCTCATACATGTGTGCCTAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305269Limch1LIM and calponin homology domains 1144111257941425001Rat

Nucleotide Sequences
GenBank Nucleotide CH473981 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
70214Niddm28Non-insulin dependent diabetes mellitus QTL 284.06blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)143999825175582726Rat
1300154Bp189Blood pressure QTL 1893.04arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)143088377768757901Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141759376142336881Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)141863134542337007Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
7387267Uae42Urinary albumin excretion QTL 420.61urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)142216796767167967Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141762256142337007Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 305332 UniSTS