RH132925 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: RH132925

Symbol:

RH132925

Previously known as:

AI535233;

RGD ID:

5048476

Expected Size:

209 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	227,981,845 - 227,982,054 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	248,397,162 - 248,397,370	NCBI	Rnor6.0
Rnor_5.0	1	255,643,687 - 255,643,895	UniSTS	Rnor5.0
RGSC_v3.4	1	233,942,575 - 233,942,783	UniSTS	RGSC3.4
Celera	1	225,125,598 - 225,125,806	UniSTS
RH 3.4 Map	1	1618.8	UniSTS
Cytogenetic Map	4	q21	UniSTS

Is Marker For:

Genes: Mios

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CAGCCGATTCCACATGATAAAG
Reverse Primer	ACCTCCTCAGGGACATAGCAAG


RefSeq Transcripts	NM_001173554	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
8693637	Alc29	Alcohol consumption QTL 29	2.7	0.258	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	234238494	Rat
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1357335	Bw39	Body weight QTL 39	3.3		body mass (VT:0001259)	body weight (CMO:0000012)	1	197814409	242814409	Rat
2302375	Bw83	Body weight QTL 83	4.87	0.0002	body mass (VT:0001259)	body weight (CMO:0000012)	1	197697768	242697768	Rat
1354652	Kidm20	Kidney mass QTL 20	4.3		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	177227632	256448636	Rat
2293674	Bss39	Bone structure and strength QTL 39	7.1	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	1	201554356	246554356	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
61455	Niddm7	Non-insulin dependent diabetes mellitus QTL 7	5.5		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	214537555	238757011	Rat
61327	Eae7	Experimental allergic encephalomyelitis QTL 7	5.6		body mass (VT:0001259)	change in body weight (CMO:0002045)	1	216255568	260522016	Rat
1600392	Bw123	Body weight QTL 123		0.001	body mass (VT:0001259)	body weight (CMO:0000012)	1	223201027	260522016	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
1578763	Kidm29	Kidney mass QTL 29	3.3	0.0001	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	1	179567751	260522016	Rat
1600395	Niddm69	Non-insulin dependent diabetes mellitus QTL 69	4.14	0.0002	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	195804352	257091168	Rat
1354624	Cm35	Cardiac mass QTL35	5.7		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	177227632	256448636	Rat
1600396	Niddm68	Non-insulin dependent diabetes mellitus QTL 68	4.97	0.0003	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
1600397	Edcs4	Endometrial carcinoma susceptibility QTL 4	2.2		uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	1	206081677	251081677	Rat
631838	Niddm36	Non-insulin dependent diabetes mellitus QTL 36		0.01	insulin secretion trait (VT:0003564)	calculated pancreatic islet insulin release measurement (CMO:0001217)	1	184550676	229550676	Rat
8693661	Alc34	Alcohol consumption QTL 34	2.2	0.611	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	228627600	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1600388	Niddm67	Non-insulin dependent diabetes mellitus QTL 67	5.84	0.000004	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
2293694	Bss38	Bone structure and strength QTL 38	7.05	0.0001	femur strength trait (VT:0010010)	femur stiffness (CMO:0001674)	1	201554356	246554356	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
8655655	Arrd2	Age-related retinal degeneration QTL 2	7.79		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	183970203	243914901	Rat
734767	Niddm57	Non-insulin dependent diabetes mellitus QTL 57			body mass (VT:0001259)	body weight (CMO:0000012)	1	224054293	260122809	Rat
1358898	Bp255	Blood pressure QTL 255	3.6		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	191019702	246062233	Rat
631215	Stl8	Serum triglyceride level QTL 8	9.27	0.0001	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	1	225126575	260522016	Rat
631843	Bw116	Body weight QTL 116	4.1	0.016	abdominal adipose amount (VT:1000220)	abdominal fat pad weight (CMO:0000088)	1	224054293	260122809	Rat
2300175	Bmd40	Bone mineral density QTL 40	15.4	0.0001	femur mineral mass (VT:0010011)	bone mineral density (CMO:0001226)	1	201554356	246554356	Rat
731175	Uae20	Urinary albumin excretion QTL 20	3.5	0.0018	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	221264111	259647894	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
724538	Kidm1	Kidney mass QTL 1	3.2		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	213707201	252085212	Rat
2293655	Bss36	Bone structure and strength QTL 36	10.66	0.0001	femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	201554356	246554356	Rat
1298084	Thym4	Thymus enlargement QTL 4	10.68		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	197814409	242814409	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
8552891	Epfw5	Epididymal fat weight QTL 5	4.4		epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	1	193113876	238113876	Rat
734769	Niddm58	Non-insulin dependent diabetes mellitus QTL 58			body mass (VT:0001259)	body weight (CMO:0000012)	1	224569538	260122809	Rat
734768	Niddm59	Non-insulin dependent diabetes mellitus QTL 59			body mass (VT:0001259)	body weight (CMO:0000012)	1	213843987	258843987	Rat
1358890	Bp259	Blood pressure QTL 259	3.06		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	210702053	260522016	Rat
724533	Rf51	Renal function QTL 51	5.3	0.0002	kidney plasma flow trait (VT:0005524)	renal plasma flow (CMO:0001914)	1	218753816	256448513	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
1358292	Cm37	Cardiac mass QTL 37	6.2	8e-07	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	1	196248093	241248093	Rat
61376	Bp42	Blood pressure QTL 42	23.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	197814409	242814409	Rat
634313	Niddm43	Non-insulin dependent diabetes mellitus QTL 43			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	199050459	259647894	Rat
1549910	Bw54	Body weight QTL 54		0.05	body mass (VT:0001259)	body weight (CMO:0000012)	1	214647894	259647894	Rat
70211	Niddm24	Non-insulin dependent diabetes mellitus QTL 24	3.79		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	214647894	259647894	Rat
1357399	Bw45	Body weight QTL 45	3.05		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	1	206329708	251329708	Rat
724552	Glom2	Glomerulus QTL 2	3.3	0.0001	kidney glomerulus morphology trait (VT:0005325)	count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)	1	222363780	260522016	Rat
1357404	Bw42	Body weight QTL 42	4.49	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	1	206329708	251329708	Rat
10053715	Scort24	Serum corticosterone level QTL 24	2.13	0.0088	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	1	221414816	260522016	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
1358916	Kidm22	Kidney mass QTL 22	3.32		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	210702053	240947965	Rat
2312564	Glom18	Glomerulus QTL 18	2.4	0.003	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	1	185356336	231689108	Rat
634321	Hc1	Hypercalciuria QTL 1	2.91		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	178810256	240830002	Rat
61400	Niddm1	Non-insulin dependent diabetes mellitus QTL 1	11		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	218753689	245907899	Rat
10059587	Bw173	Body weight QTL 173	3.23	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	1	202069611	247069611	Rat
2292216	Bw80	Body weight QTL 80	3.23	0.0019	body mass (VT:0001259)	body weight (CMO:0000012)	1	213533809	243914901	Rat
1300168	Bp170	Blood pressure QTL 170	2.76		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	207702246	228581766	Rat
2292220	Bp306	Blood pressure QTL 306	3.47	0.00087	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	243914901	Rat
10059590	Kidm44	Kidney mass QTL 44	3.42	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	191033875	236033875	Rat
1641926	Teswt2	Testicular weight QTL 2	2.82		testis mass (VT:1000644)	both testes wet weight (CMO:0000175)	1	197697768	238755659	Rat
631658	Cm7	Cardiac mass QTL 7	5.32	0.0001	aorta mass (VT:0002845)	aorta weight (CMO:0000076)	1	196248093	241248093	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
2293700	Bmd27	Bone mineral density QTL 27	6.6	0.0001	femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	224054293	243747962	Rat
2293701	Bmd34	Bone mineral density QTL 34	8.3	0.0001	femur strength trait (VT:0010010)	femoral neck ultimate force (CMO:0001703)	1	224054293	243747962	Rat
7387289	Uae45	Urinary albumin excretion QTL 45	2.86	0.0021	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	223262787	260522016	Rat
8655855	Arrd3	Age-related retinal degeneration QTL 3	3.07		lens clarity trait (VT:0001304)	cataract incidence/prevalence measurement (CMO:0001585)	1	183970203	243914901	Rat
1600374	Mcs17	Mammary carcinoma susceptibility QTL 17	3		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	1	197670404	242670404	Rat
1600363	Hc6	Hypercalciuria QTL 6	2.7		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	203995416	244113296	Rat
8693618	Alc25	Alcohol consumption QTL 25	3	0.28	drinking behavior trait (VT:0001422)	calculated ethanol drink intake rate (CMO:0001615)	1	207987464	228627600	Rat
738032	Hcas5	Hepatocarcinoma susceptibility QTL 5	3.12		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	176426412	257976495	Rat
1358191	Ept10	Estrogen-induced pituitary tumorigenesis QTL 10	3.8		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	192825253	243914732	Rat
2302040	Pia35	Pristane induced arthritis QTL 35	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	216255568	260522016	Rat
7394701	Uae46	Urinary albumin excretion QTL 46	3.6	0.0056	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	201554356	246554356	Rat
1598821	Rf55	Renal function QTL 55	6.3		renal blood flow trait (VT:2000006)	ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)	1	218748008	257976495	Rat

Database	Acc Id	Source(s)
NCBI Gene	362324	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: RH132925