RH132870 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH132870

Symbol: RH132870
Previously known as: AI511208; 
RGD ID: 5048380
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21072,987,383 - 72,987,598 (+)MAPPERmRatBN7.2
Rnor_6.01075,517,118 - 75,517,332NCBIRnor6.0
Rnor_5.01074,589,053 - 74,589,267UniSTSRnor5.0
RGSC_v3.41076,488,974 - 76,489,188UniSTSRGSC3.4
Celera1071,896,755 - 71,896,969UniSTS




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CACACACAAACCTAGGCCTTCC
Reverse Primer CACGCTGAGAGTGACCAAGTTT
 
GenBank Nucleotide JH617084.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 82 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
631565Hcuc4Hepatic copper content QTL 44.15liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)106694181373452992Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
152025224Bw193Body weight QTL 1936.47body mass (VT:0001259)105166340575085664Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat

1 to 10 of 82 rows