D5Wox1 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Wox1

Symbol: D5Wox1
Previously known as: oxsts5052; RCA09.15; 
RGD ID: 44011
Expected Size: 268 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr85165,233,987 - 165,234,255 (+)Marker Load Pipeline
Rnor_5.05170,099,102 - 170,099,371NCBIRnor5.0
RGSC_v3.45166,590,044 - 166,590,312RGDRGSC3.4
RGSC_v3.15166,600,232 - 166,600,500RGD
RH 3.4 Map51116.7UniSTS
RH 3.4 Map51116.7RGD
RH 2.0 Map51116.7RGD
Cytogenetic Map5 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer GCCTGTCGATCTTTAGCCC
Reverse Primer CCACTTCGAAATTTTCTGGT
 

Region

Nucleotide Sequences
GenBank Nucleotide AJ230889 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5130249266172190305Rat
1354583Despr3Despair related QTL34.980.0002locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)5132930505172190305Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5141212838172190305Rat
1300119Bp180Blood pressure QTL 1803.82arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5149642129171146538Rat
1549904Neuinf1Neuroinflammation QTL 130nervous system integrity trait (VT:0010566)blood T lymphocyte count (CMO:0000110)5160111176171146538Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)599905133172190305Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5133789363172190305Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5134369199172190305Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)565089051166764498Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5136631198172190305Rat
1354631Swd2Spike wave discharge measurement QTL 23.640.0002brain electrophysiology trait (VT:0010557)brain total spike-and-wave discharge duration (CMO:0001740)5156396728172190305Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5133081618172190305Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)551657967166600247Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5138002522170842766Rat
1581505Rf54Renal function QTL 54kidney physiology trait (VT:0002136)kidney 20-HETE level (CMO:0001854)5133270647172190305Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5160071170172129029Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)5141764300172190305Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5133789363172190305Rat
1331721Bp210Blood pressure QTL 2103.413arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5148093485172129029Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5125969677172190305Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555124766172190305Rat
631272Lanf1Left ventricular atrial natriuretic factor QTL 112heart left ventricle natriuretic peptide A amount (VT:0010596)heart left ventricle natriuretic peptide A level (CMO:0002165)5156396728167181764Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5131708216172190305Rat
2313096Bmd78Bone mineral density QTL 783.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)5149661912166600247Rat
1298090Bp155Blood pressure QTL 1553.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)5156289283171137955Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5133081618172190305Rat


Additional Information

RGD Curation Notes
Note Type Note Reference