D2Got12 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D2Got12

Symbol: D2Got12
Previously known as: oxsts1677; OT47.43; 
RGD ID: 43486
Expected Size: 108 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2234,763,140 - 34,763,246 (+)MAPPERmRatBN7.2
Rnor_6.0233,718,714 - 33,718,819NCBIRnor6.0
Rnor_5.0252,849,485 - 52,849,590UniSTSRnor5.0
RGSC_v3.4234,813,815 - 34,813,921RGDRGSC3.4
RGSC_v3.4234,813,816 - 34,813,921UniSTSRGSC3.4
RGSC_v3.1234,734,185 - 34,734,290RGD
Celera230,743,043 - 30,743,143UniSTS
RH 3.4 Map2129.7UniSTS
RH 3.4 Map2129.7RGD
RH 2.0 Map2203.3RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CACAAATGTACTTTGCACCCA
Reverse Primer AAGCCCATTGTTTTAGACAATG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026394 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U86143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
7387318Stl32Serum triglyceride level QTL 323.20.0003blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)22238462767384627Rat
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
10755434Coatc7Coat color QTL 70.04794coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23064806575648065Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)218960362228801039Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1300160Hrtrt3Heart rate QTL 33.62heart pumping trait (VT:2000009)absolute change in heart rate (CMO:0000534)22997159351729300Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
10402051Gdil2Gastrointestinal dilation QTL 2enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)22490385374786777Rat
9590095Sffal3Serum free fatty acids level QTL 36.780.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)22715716072157160Rat
1331764Bp205Blood pressure QTL 2053.476arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22699957143154682Rat
731179Mamtr3Mammary tumor resistance QTL 30.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)23237377043665178Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1643006Pain1Pain QTL 13.630.005mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)22699957148268661Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)22691781781754745Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
152025206Hrtrt23Heart rate QTL 235.98heart pumping trait (VT:2000009)228484589169504100Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
152025204Hrtrt22Heart rate QTL 225.6heart pumping trait (VT:2000009)228484589169504100Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat


Additional Information