Symbol:
Klhl24
Name:
kelch-like family member 24
RGD ID:
727971
Description:
Predicted to enable ubiquitin-like ligase-substrate adaptor activity. Predicted to be involved in intermediate filament organization; proteasome-mediated ubiquitin-dependent protein catabolic process; and protein autoubiquitination. Predicted to be located in adherens junction and desmosome. Predicted to be part of Cul3-RING ubiquitin ligase complex. Predicted to be active in cytoplasm. Human ortholog(s) of this gene implicated in epidermolysis bullosa simplex and familial hypertrophic cardiomyopathy. Orthologous to human KLHL24 (kelch like family member 24); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
Dre1; kainate receptor-interacting protein for GluR6; kelch-like 24; kelch-like 24 (Drosophila); kelch-like protein 24; KRIP6; MGC105289
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 11 94,348,024 - 94,382,085 (-) NCBI GRCr8 mRatBN7.2 11 80,843,621 - 80,877,649 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 11 80,846,755 - 80,877,636 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 11 89,566,617 - 89,597,436 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 11 82,219,965 - 82,250,790 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 11 81,281,103 - 81,311,931 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 11 84,613,101 - 84,643,674 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 11 84,615,760 - 84,633,504 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 11 87,675,249 - 87,705,822 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 11 83,094,560 - 83,126,617 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 11 83,152,149 - 83,184,206 (-) NCBI Celera 11 79,681,696 - 79,711,857 (-) NCBI Celera Cytogenetic Map 11 q23 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Klhl24 Rat (-)-alpha-phellandrene increases expression ISO KLHL24 (Homo sapiens) 6480464 alpha phellandrene results in increased expression of KLHL24 mRNA CTD PMID:25075043 Klhl24 Rat (-)-demecolcine increases expression ISO KLHL24 (Homo sapiens) 6480464 Demecolcine results in increased expression of KLHL24 mRNA CTD PMID:23649840 Klhl24 Rat 1,2-dichloroethane decreases expression ISO Klhl24 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of KLHL24 mRNA CTD PMID:28189721 and PMID:28960355 Klhl24 Rat 1,2-dimethylhydrazine decreases expression ISO Klhl24 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of KLHL24 mRNA CTD PMID:22206623 Klhl24 Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of KLHL24 mRNA CTD PMID:29097150 Klhl24 Rat 17beta-estradiol multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of KLHL24 mRNA CTD PMID:20660070 Klhl24 Rat 17beta-estradiol decreases expression ISO KLHL24 (Homo sapiens) 6480464 Estradiol results in decreased expression of KLHL24 mRNA CTD PMID:31614463 Klhl24 Rat 17beta-estradiol decreases expression ISO Klhl24 (Mus musculus) 6480464 Estradiol results in decreased expression of KLHL24 mRNA CTD PMID:39298647 Klhl24 Rat 17beta-estradiol affects expression EXP 6480464 Estradiol affects the expression of KLHL24 mRNA CTD PMID:32145629 Klhl24 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO KLHL24 (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 Klhl24 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of KLHL24 mRNA CTD PMID:21215274 Klhl24 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of KLHL24 mRNA CTD PMID:23238561 and PMID:32109520 Klhl24 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Klhl24 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of KLHL24 mRNA CTD PMID:23238561 Klhl24 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Klhl24 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of KLHL24 mRNA CTD PMID:21570461 Klhl24 Rat 2-hydroxypropanoic acid increases expression ISO KLHL24 (Homo sapiens) 6480464 Lactic Acid results in increased expression of KLHL24 mRNA CTD PMID:30851411 Klhl24 Rat 3,3',4,4'-tetrachlorobiphenyl affects expression ISO KLHL24 (Homo sapiens) 6480464 3 more ... CTD PMID:20638727 Klhl24 Rat 3,4-dichloroaniline increases expression EXP 6480464 3 and 4-dichloroaniline results in increased expression of KLHL24 mRNA CTD PMID:24172598 Klhl24 Rat 4,4'-sulfonyldiphenol decreases expression ISO Klhl24 (Mus musculus) 6480464 bisphenol S results in decreased expression of KLHL24 mRNA CTD PMID:39298647 Klhl24 Rat 4-hydroxyphenyl retinamide increases expression ISO Klhl24 (Mus musculus) 6480464 Fenretinide results in increased expression of KLHL24 mRNA CTD PMID:28973697 Klhl24 Rat 4-hydroxyphenyl retinamide decreases expression ISO Klhl24 (Mus musculus) 6480464 Fenretinide results in decreased expression of KLHL24 mRNA CTD PMID:28973697 Klhl24 Rat 5-aza-2'-deoxycytidine affects expression ISO KLHL24 (Homo sapiens) 6480464 Decitabine affects the expression of KLHL24 mRNA CTD PMID:23300844 Klhl24 Rat 5-fluorouracil increases expression ISO KLHL24 (Homo sapiens) 6480464 Fluorouracil results in increased expression of KLHL24 mRNA CTD PMID:16510598 Klhl24 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of KLHL24 mRNA CTD PMID:30047161 Klhl24 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of KLHL24 mRNA CTD PMID:31881176 Klhl24 Rat actinomycin D multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of KLHL24 mRNA CTD PMID:38460933 Klhl24 Rat aflatoxin B1 increases expression ISO Klhl24 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of KLHL24 mRNA CTD PMID:19770486 Klhl24 Rat aflatoxin B1 increases expression ISO KLHL24 (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of KLHL24 mRNA CTD PMID:21641981 Klhl24 Rat all-trans-retinoic acid increases expression ISO KLHL24 (Homo sapiens) 6480464 Tretinoin results in increased expression of KLHL24 mRNA CTD PMID:23724009 and PMID:23830798 Klhl24 Rat alpha-phellandrene increases expression ISO KLHL24 (Homo sapiens) 6480464 alpha phellandrene results in increased expression of KLHL24 mRNA CTD PMID:25075043 Klhl24 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of KLHL24 mRNA CTD PMID:30047161 Klhl24 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of KLHL24 mRNA CTD PMID:16483693 Klhl24 Rat amphotericin B decreases expression ISO KLHL24 (Homo sapiens) 6480464 Amphotericin B analog results in decreased expression of KLHL24 mRNA CTD PMID:28534445 Klhl24 Rat antimycin A increases expression ISO KLHL24 (Homo sapiens) 6480464 Antimycin A results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat arsenite(3-) multiple interactions ISO KLHL24 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to KLHL24 mRNA] CTD PMID:32406909 Klhl24 Rat arsenous acid increases expression ISO KLHL24 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of KLHL24 mRNA CTD PMID:20458559 more ... Klhl24 Rat avobenzone increases expression ISO KLHL24 (Homo sapiens) 6480464 avobenzone results in increased expression of KLHL24 mRNA CTD PMID:31016361 Klhl24 Rat benzo[a]pyrene increases expression ISO KLHL24 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of KLHL24 mRNA CTD PMID:20064835 Klhl24 Rat benzo[a]pyrene affects methylation ISO KLHL24 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of KLHL24 5' UTR CTD PMID:27901495 Klhl24 Rat benzo[a]pyrene decreases expression ISO Klhl24 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of KLHL24 mRNA CTD PMID:19770486 Klhl24 Rat benzo[a]pyrene diol epoxide I decreases expression ISO KLHL24 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Klhl24 Rat bisphenol A increases expression ISO KLHL24 (Homo sapiens) 6480464 bisphenol A analog results in increased expression of KLHL24 mRNA and bisphenol A results in increased expression of KLHL24 mRNA CTD PMID:29275510 and PMID:32387340 Klhl24 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of KLHL24 mRNA CTD PMID:32145629 Klhl24 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of KLHL24 mRNA CTD PMID:29097150 Klhl24 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of KLHL24 mRNA CTD PMID:25181051 Klhl24 Rat bisphenol A decreases expression ISO KLHL24 (Homo sapiens) 6480464 bisphenol A results in decreased expression of KLHL24 mRNA CTD PMID:20678512 Klhl24 Rat bisphenol F increases expression ISO Klhl24 (Mus musculus) 6480464 bisphenol F results in increased expression of KLHL24 mRNA CTD PMID:38685157 Klhl24 Rat buspirone increases expression EXP 6480464 Buspirone results in increased expression of KLHL24 mRNA CTD PMID:24136188 Klhl24 Rat butanal decreases expression ISO KLHL24 (Homo sapiens) 6480464 butyraldehyde results in decreased expression of KLHL24 mRNA CTD PMID:26079696 Klhl24 Rat cadmium atom multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KLHL24 mRNA CTD PMID:35301059 Klhl24 Rat cadmium dichloride increases expression ISO Klhl24 (Mus musculus) 6480464 Cadmium Chloride results in increased expression of KLHL24 mRNA CTD PMID:20883709 Klhl24 Rat cadmium dichloride multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KLHL24 mRNA CTD PMID:35301059 Klhl24 Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of KLHL24 mRNA CTD PMID:33453195 Klhl24 Rat cadmium sulfate multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [cadmium sulfate co-treated with cobaltous chloride co-treated with lead chloride] results in increased expression of KLHL24 mRNA CTD PMID:18654764 Klhl24 Rat captan decreases expression ISO Klhl24 (Mus musculus) 6480464 Captan results in decreased expression of KLHL24 mRNA CTD PMID:31558096 Klhl24 Rat carbon nanotube decreases expression ISO Klhl24 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Klhl24 Rat CGP 52608 multiple interactions ISO KLHL24 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to KLHL24 gene] CTD PMID:28238834 Klhl24 Rat cisplatin affects expression ISO KLHL24 (Homo sapiens) 6480464 Cisplatin affects the expression of KLHL24 mRNA CTD PMID:23300844 Klhl24 Rat cobalt dichloride multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [cadmium sulfate co-treated with cobaltous chloride co-treated with lead chloride] results in increased expression of KLHL24 mRNA CTD PMID:18654764 Klhl24 Rat cobalt dichloride increases expression ISO KLHL24 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of KLHL24 mRNA CTD PMID:19320972 more ... Klhl24 Rat copper atom multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of KLHL24 mRNA CTD PMID:20971185 Klhl24 Rat copper atom increases expression EXP 6480464 Copper results in increased expression of KLHL24 mRNA CTD PMID:30556269 Klhl24 Rat copper(0) multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of KLHL24 mRNA CTD PMID:20971185 Klhl24 Rat copper(0) increases expression EXP 6480464 Copper results in increased expression of KLHL24 mRNA CTD PMID:30556269 Klhl24 Rat copper(II) sulfate increases expression ISO KLHL24 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of KLHL24 mRNA CTD PMID:19549813 Klhl24 Rat coumestrol decreases expression ISO KLHL24 (Homo sapiens) 6480464 Coumestrol results in decreased expression of KLHL24 mRNA CTD PMID:19167446 Klhl24 Rat coumestrol multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of KLHL24 mRNA CTD PMID:19167446 Klhl24 Rat crocidolite asbestos increases expression ISO KLHL24 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of KLHL24 mRNA CTD PMID:18687144 Klhl24 Rat curcumin decreases expression ISO KLHL24 (Homo sapiens) 6480464 Curcumin results in decreased expression of KLHL24 mRNA CTD PMID:17198877 Klhl24 Rat cyclosporin A decreases expression ISO Klhl24 (Mus musculus) 6480464 Cyclosporine results in decreased expression of KLHL24 mRNA CTD PMID:19770486 Klhl24 Rat cyclosporin A increases methylation ISO KLHL24 (Homo sapiens) 6480464 Cyclosporine results in increased methylation of KLHL24 promoter CTD PMID:27989131 Klhl24 Rat DDE decreases expression ISO KLHL24 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of KLHL24 mRNA CTD PMID:38568856 Klhl24 Rat deguelin increases expression ISO KLHL24 (Homo sapiens) 6480464 deguelin results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat diarsenic trioxide increases expression ISO KLHL24 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of KLHL24 mRNA CTD PMID:20458559 more ... Klhl24 Rat diazinon increases expression ISO KLHL24 (Homo sapiens) 6480464 Diazinon results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat Dibutyl phosphate affects expression ISO KLHL24 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of KLHL24 mRNA CTD PMID:37042841 Klhl24 Rat dibutyl phthalate increases expression ISO Klhl24 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of KLHL24 mRNA CTD PMID:21266533 Klhl24 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of KLHL24 mRNA CTD PMID:24893172 Klhl24 Rat Didecyldimethylammonium increases expression ISO KLHL24 (Homo sapiens) 6480464 didecyldimethylammonium results in increased expression of KLHL24 mRNA CTD PMID:32763356 Klhl24 Rat dioxygen multiple interactions ISO Klhl24 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of KLHL24 mRNA CTD PMID:30529165 Klhl24 Rat diuron increases expression EXP 6480464 Diuron metabolite results in increased expression of KLHL24 mRNA CTD PMID:24172598 Klhl24 Rat dorsomorphin multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Klhl24 Rat doxorubicin increases expression ISO Klhl24 (Mus musculus) 6480464 Doxorubicin results in increased expression of KLHL24 mRNA CTD PMID:25896364 Klhl24 Rat doxorubicin decreases expression ISO KLHL24 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of KLHL24 mRNA CTD PMID:29803840 Klhl24 Rat elemental selenium multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in increased expression of KLHL24 mRNA CTD PMID:19244175 Klhl24 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of KLHL24 mRNA CTD PMID:29391264 Klhl24 Rat Enterolactone multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of KLHL24 mRNA CTD PMID:19167446 Klhl24 Rat entinostat decreases expression ISO KLHL24 (Homo sapiens) 6480464 entinostat results in decreased expression of KLHL24 mRNA CTD PMID:27188386 Klhl24 Rat ethanol affects splicing ISO Klhl24 (Mus musculus) 6480464 Ethanol affects the splicing of KLHL24 mRNA CTD PMID:30319688 Klhl24 Rat ethyl methanesulfonate increases expression ISO KLHL24 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of KLHL24 mRNA CTD PMID:23649840 Klhl24 Rat fenpyroximate increases expression ISO KLHL24 (Homo sapiens) 6480464 fenpyroximate results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat fenthion decreases expression ISO Klhl24 (Mus musculus) 6480464 Fenthion results in decreased expression of KLHL24 mRNA CTD PMID:34813904 Klhl24 Rat fingolimod hydrochloride increases expression ISO KLHL24 (Homo sapiens) 6480464 Fingolimod Hydrochloride results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat fluoxetine increases expression ISO KLHL24 (Homo sapiens) 6480464 Fluoxetine results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat folpet decreases expression ISO Klhl24 (Mus musculus) 6480464 folpet results in decreased expression of KLHL24 mRNA CTD PMID:31558096 Klhl24 Rat formaldehyde increases expression ISO KLHL24 (Homo sapiens) 6480464 Formaldehyde results in increased expression of KLHL24 mRNA CTD PMID:23649840 Klhl24 Rat FR900359 increases phosphorylation ISO KLHL24 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of KLHL24 protein CTD PMID:37730182 Klhl24 Rat gamma-hexachlorocyclohexane increases expression ISO KLHL24 (Homo sapiens) 6480464 Hexachlorocyclohexane results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat geldanamycin increases expression ISO KLHL24 (Homo sapiens) 6480464 geldanamycin results in increased expression of KLHL24 mRNA CTD PMID:26705709 Klhl24 Rat genistein increases expression ISO KLHL24 (Homo sapiens) 6480464 Genistein results in increased expression of KLHL24 mRNA CTD PMID:18847459 Klhl24 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of KLHL24 mRNA CTD PMID:33387578 Klhl24 Rat hydrogen peroxide affects expression ISO KLHL24 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of KLHL24 mRNA CTD PMID:20044591 Klhl24 Rat irinotecan increases expression ISO KLHL24 (Homo sapiens) 6480464 Irinotecan analog results in increased expression of KLHL24 mRNA CTD PMID:18927307 Klhl24 Rat isoprenaline increases expression ISO Klhl24 (Mus musculus) 6480464 Isoproterenol results in increased expression of KLHL24 mRNA CTD PMID:20003209 Klhl24 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of KLHL24 mRNA CTD PMID:20080153 Klhl24 Rat lead(II) chloride multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [cadmium sulfate co-treated with cobaltous chloride co-treated with lead chloride] results in increased expression of KLHL24 mRNA CTD PMID:18654764 Klhl24 Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of KLHL24 mRNA CTD PMID:30467583 Klhl24 Rat methidathion decreases expression ISO Klhl24 (Mus musculus) 6480464 methidathion results in decreased expression of KLHL24 mRNA CTD PMID:34813904 Klhl24 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of KLHL24 mRNA CTD PMID:30047161 Klhl24 Rat methyl methanesulfonate increases expression ISO KLHL24 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of KLHL24 mRNA CTD PMID:23649840 Klhl24 Rat methylmercury chloride decreases expression ISO KLHL24 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of KLHL24 mRNA CTD PMID:28001369 Klhl24 Rat methylmercury chloride increases expression ISO KLHL24 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of KLHL24 mRNA CTD PMID:28001369 Klhl24 Rat miconazole decreases expression ISO Klhl24 (Mus musculus) 6480464 Miconazole results in decreased expression of KLHL24 mRNA CTD PMID:27462272 Klhl24 Rat nickel dichloride increases expression ISO KLHL24 (Homo sapiens) 6480464 nickel chloride results in increased expression of KLHL24 mRNA CTD PMID:21455298 Klhl24 Rat niclosamide increases expression ISO KLHL24 (Homo sapiens) 6480464 Niclosamide results in increased expression of KLHL24 mRNA CTD PMID:36318118 Klhl24 Rat Nutlin-3 multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of KLHL24 mRNA CTD PMID:38460933 Klhl24 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of KLHL24 mRNA CTD PMID:25729387 Klhl24 Rat paracetamol affects expression ISO Klhl24 (Mus musculus) 6480464 Acetaminophen affects the expression of KLHL24 mRNA CTD PMID:17562736 Klhl24 Rat paracetamol affects expression ISO KLHL24 (Homo sapiens) 6480464 Acetaminophen affects the expression of KLHL24 mRNA CTD PMID:25458485 Klhl24 Rat paracetamol increases expression ISO KLHL24 (Homo sapiens) 6480464 Acetaminophen results in increased expression of KLHL24 mRNA CTD PMID:21420995 and PMID:26690555 Klhl24 Rat phenobarbital multiple interactions ISO Klhl24 (Mus musculus) 6480464 NR1I3 protein affects the reaction [Phenobarbital results in decreased expression of KLHL24 mRNA] CTD PMID:19482888 Klhl24 Rat phenobarbital decreases expression ISO Klhl24 (Mus musculus) 6480464 Phenobarbital results in decreased expression of KLHL24 mRNA CTD PMID:19270015 more ... Klhl24 Rat phenobarbital increases expression ISO Klhl24 (Mus musculus) 6480464 Phenobarbital results in increased expression of KLHL24 mRNA CTD PMID:19270015 Klhl24 Rat phenylephrine decreases expression EXP 6480464 Phenylephrine results in decreased expression of KLHL24 mRNA CTD PMID:18158353 Klhl24 Rat picoxystrobin increases expression ISO KLHL24 (Homo sapiens) 6480464 picoxystrobin results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat pirinixic acid multiple interactions ISO Klhl24 (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of KLHL24 mRNA CTD PMID:19710929 Klhl24 Rat pirinixic acid increases expression ISO Klhl24 (Mus musculus) 6480464 pirinixic acid results in increased expression of KLHL24 mRNA CTD PMID:18301758 Klhl24 Rat prednisolone increases expression ISO KLHL24 (Homo sapiens) 6480464 Prednisolone results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat progesterone multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of KLHL24 mRNA CTD PMID:20660070 Klhl24 Rat propanal decreases expression ISO KLHL24 (Homo sapiens) 6480464 propionaldehyde results in decreased expression of KLHL24 mRNA CTD PMID:26079696 Klhl24 Rat propiconazole decreases expression ISO Klhl24 (Mus musculus) 6480464 propiconazole results in decreased expression of KLHL24 mRNA CTD PMID:21278054 Klhl24 Rat pyrimidifen increases expression ISO KLHL24 (Homo sapiens) 6480464 pyrimidifen results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat rac-lactic acid increases expression ISO KLHL24 (Homo sapiens) 6480464 Lactic Acid results in increased expression of KLHL24 mRNA CTD PMID:30851411 Klhl24 Rat raloxifene increases expression ISO KLHL24 (Homo sapiens) 6480464 Raloxifene Hydrochloride results in increased expression of KLHL24 mRNA CTD PMID:19429434 Klhl24 Rat resveratrol multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of KLHL24 mRNA CTD PMID:23557933 Klhl24 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of KLHL24 mRNA CTD PMID:19013527 Klhl24 Rat rotenone increases expression ISO KLHL24 (Homo sapiens) 6480464 Rotenone results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat SB 431542 multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Klhl24 Rat selenium atom multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in increased expression of KLHL24 mRNA CTD PMID:19244175 Klhl24 Rat silicon dioxide decreases expression ISO KLHL24 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of KLHL24 mRNA CTD PMID:25895662 Klhl24 Rat silver atom increases expression ISO KLHL24 (Homo sapiens) 6480464 Silver results in increased expression of KLHL24 mRNA CTD PMID:26014281 Klhl24 Rat silver(0) increases expression ISO KLHL24 (Homo sapiens) 6480464 Silver results in increased expression of KLHL24 mRNA CTD PMID:26014281 Klhl24 Rat sirolimus increases expression ISO KLHL24 (Homo sapiens) 6480464 Sirolimus results in increased expression of KLHL24 mRNA CTD PMID:24356939 Klhl24 Rat sirolimus multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [(+)-JQ1 compound co-treated with Sirolimus] affects the expression of KLHL24 mRNA CTD PMID:25307878 Klhl24 Rat sodium arsenate increases expression ISO Klhl24 (Mus musculus) 6480464 sodium arsenate results in increased expression of KLHL24 mRNA CTD PMID:21795629 Klhl24 Rat sodium arsenite increases expression ISO Klhl24 (Mus musculus) 6480464 sodium arsenite results in increased expression of KLHL24 mRNA CTD PMID:20883709 Klhl24 Rat sodium arsenite affects expression ISO KLHL24 (Homo sapiens) 6480464 sodium arsenite affects the expression of KLHL24 mRNA CTD PMID:34032870 Klhl24 Rat sodium arsenite increases expression ISO KLHL24 (Homo sapiens) 6480464 sodium arsenite results in increased expression of KLHL24 mRNA CTD PMID:38568856 Klhl24 Rat sodium arsenite decreases expression ISO KLHL24 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of KLHL24 mRNA CTD PMID:28595984 Klhl24 Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of KLHL24 mRNA CTD PMID:30047161 Klhl24 Rat sunitinib increases expression ISO KLHL24 (Homo sapiens) 6480464 Sunitinib results in increased expression of KLHL24 mRNA CTD PMID:31533062 Klhl24 Rat tebufenpyrad increases expression ISO KLHL24 (Homo sapiens) 6480464 4-chloro-N-((4-(1 and 1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide results in increased expression of KLHL24 mRNA CTD PMID:34642769 Klhl24 Rat testosterone affects expression ISO Klhl24 (Mus musculus) 6480464 Testosterone affects the expression of KLHL24 mRNA CTD PMID:20403060 Klhl24 Rat testosterone increases expression ISO KLHL24 (Homo sapiens) 6480464 Testosterone results in increased expression of KLHL24 mRNA CTD PMID:33359661 Klhl24 Rat testosterone enanthate affects expression ISO KLHL24 (Homo sapiens) 6480464 testosterone enanthate affects the expression of KLHL24 mRNA CTD PMID:17440010 Klhl24 Rat tetrachloroethene increases expression ISO Klhl24 (Mus musculus) 6480464 Tetrachloroethylene results in increased expression of KLHL24 mRNA CTD PMID:28973375 Klhl24 Rat tetrachloromethane decreases expression ISO Klhl24 (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of KLHL24 mRNA CTD PMID:31919559 Klhl24 Rat thifluzamide decreases expression ISO KLHL24 (Homo sapiens) 6480464 thifluzamide results in decreased expression of KLHL24 mRNA CTD PMID:33512557 Klhl24 Rat thimerosal decreases expression ISO KLHL24 (Homo sapiens) 6480464 Thimerosal results in decreased expression of KLHL24 mRNA CTD PMID:27188386 Klhl24 Rat thiram increases expression ISO KLHL24 (Homo sapiens) 6480464 Thiram results in increased expression of KLHL24 mRNA CTD PMID:38568856 Klhl24 Rat titanium dioxide increases methylation ISO Klhl24 (Mus musculus) 6480464 titanium dioxide results in increased methylation of KLHL24 gene CTD PMID:35295148 Klhl24 Rat titanium dioxide decreases expression ISO Klhl24 (Mus musculus) 6480464 titanium dioxide results in decreased expression of KLHL24 mRNA CTD PMID:27760801 Klhl24 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of KLHL24 mRNA CTD PMID:25729387 Klhl24 Rat torcetrapib increases expression ISO KLHL24 (Homo sapiens) 6480464 torcetrapib results in increased expression of KLHL24 mRNA CTD PMID:23228038 Klhl24 Rat tremolite asbestos decreases expression ISO Klhl24 (Mus musculus) 6480464 tremolite results in decreased expression of KLHL24 mRNA CTD PMID:29279043 Klhl24 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of KLHL24 mRNA CTD PMID:33387578 Klhl24 Rat trichostatin A decreases expression ISO KLHL24 (Homo sapiens) 6480464 trichostatin A results in decreased expression of KLHL24 mRNA CTD PMID:24935251 and PMID:26272509 Klhl24 Rat trichostatin A affects expression ISO KLHL24 (Homo sapiens) 6480464 trichostatin A affects the expression of KLHL24 mRNA CTD PMID:28542535 Klhl24 Rat trichostatin A multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of KLHL24 mRNA CTD PMID:27188386 Klhl24 Rat troglitazone decreases expression ISO Klhl24 (Mus musculus) 6480464 troglitazone results in decreased expression of KLHL24 mRNA CTD PMID:28973697 Klhl24 Rat trovafloxacin increases expression EXP 6480464 trovafloxacin results in increased expression of KLHL24 mRNA CTD PMID:24136188 Klhl24 Rat trovafloxacin decreases expression ISO Klhl24 (Mus musculus) 6480464 trovafloxacin results in decreased expression of KLHL24 mRNA CTD PMID:35537566 Klhl24 Rat urethane increases expression ISO KLHL24 (Homo sapiens) 6480464 Urethane results in increased expression of KLHL24 mRNA CTD PMID:28818685 Klhl24 Rat valdecoxib increases expression EXP 6480464 valdecoxib results in increased expression of KLHL24 mRNA CTD PMID:24136188 Klhl24 Rat valproic acid increases expression ISO KLHL24 (Homo sapiens) 6480464 Valproic Acid results in increased expression of KLHL24 mRNA CTD PMID:24935251 Klhl24 Rat valproic acid decreases expression ISO KLHL24 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of KLHL24 mRNA CTD PMID:23179753 more ... Klhl24 Rat valproic acid multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of KLHL24 mRNA CTD PMID:27188386 Klhl24 Rat venlafaxine hydrochloride increases expression EXP 6480464 Venlafaxine Hydrochloride results in increased expression of KLHL24 mRNA CTD PMID:25423262 Klhl24 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of KLHL24 mRNA CTD PMID:19015723 Klhl24 Rat vitamin E multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [Selenium co-treated with Vitamin E] results in increased expression of KLHL24 mRNA CTD PMID:19244175 Klhl24 Rat vorinostat decreases expression ISO KLHL24 (Homo sapiens) 6480464 vorinostat results in decreased expression of KLHL24 mRNA CTD PMID:27188386 Klhl24 Rat zinc atom multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of KLHL24 mRNA CTD PMID:18593933 Klhl24 Rat zinc(0) multiple interactions ISO KLHL24 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of KLHL24 mRNA CTD PMID:18593933
(-)-alpha-phellandrene (ISO) (-)-demecolcine (ISO) 1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP,ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2-hydroxypropanoic acid (ISO) 3,3',4,4'-tetrachlorobiphenyl (ISO) 3,4-dichloroaniline (EXP) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (ISO) 5-fluorouracil (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-phellandrene (ISO) amitrole (EXP) ammonium chloride (EXP) amphotericin B (ISO) antimycin A (ISO) arsenite(3-) (ISO) arsenous acid (ISO) avobenzone (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) buspirone (EXP) butanal (ISO) cadmium atom (ISO) cadmium dichloride (EXP,ISO) cadmium sulfate (ISO) captan (ISO) carbon nanotube (ISO) CGP 52608 (ISO) cisplatin (ISO) cobalt dichloride (ISO) copper atom (EXP,ISO) copper(0) (EXP,ISO) copper(II) sulfate (ISO) coumestrol (ISO) crocidolite asbestos (ISO) curcumin (ISO) cyclosporin A (ISO) DDE (ISO) deguelin (ISO) diarsenic trioxide (ISO) diazinon (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) Didecyldimethylammonium (ISO) dioxygen (ISO) diuron (EXP) dorsomorphin (ISO) doxorubicin (ISO) elemental selenium (ISO) endosulfan (EXP) Enterolactone (ISO) entinostat (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fenpyroximate (ISO) fenthion (ISO) fingolimod hydrochloride (ISO) fluoxetine (ISO) folpet (ISO) formaldehyde (ISO) FR900359 (ISO) gamma-hexachlorocyclohexane (ISO) geldanamycin (ISO) genistein (ISO) gentamycin (EXP) hydrogen peroxide (ISO) irinotecan (ISO) isoprenaline (ISO) ketamine (EXP) lead(II) chloride (ISO) methapyrilene (EXP) methidathion (ISO) methimazole (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) miconazole (ISO) nickel dichloride (ISO) niclosamide (ISO) Nutlin-3 (ISO) oxaliplatin (EXP) paracetamol (ISO) phenobarbital (ISO) phenylephrine (EXP) picoxystrobin (ISO) pirinixic acid (ISO) prednisolone (ISO) progesterone (ISO) propanal (ISO) propiconazole (ISO) pyrimidifen (ISO) rac-lactic acid (ISO) raloxifene (ISO) resveratrol (ISO) rotenone (EXP,ISO) SB 431542 (ISO) selenium atom (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sirolimus (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sulfadimethoxine (EXP) sunitinib (ISO) tebufenpyrad (ISO) testosterone (ISO) testosterone enanthate (ISO) tetrachloroethene (ISO) tetrachloromethane (ISO) thifluzamide (ISO) thimerosal (ISO) thiram (ISO) titanium dioxide (ISO) topotecan (EXP) torcetrapib (ISO) tremolite asbestos (ISO) trichloroethene (EXP) trichostatin A (ISO) troglitazone (ISO) trovafloxacin (EXP,ISO) urethane (ISO) valdecoxib (EXP) valproic acid (ISO) venlafaxine hydrochloride (EXP) vinclozolin (EXP) vitamin E (ISO) vorinostat (ISO) zinc atom (ISO) zinc(0) (ISO)
Cellular Component
adherens junction (IEA,ISO,ISS) anchoring junction (IEA) axon (IEA) cell projection (IEA) Cul3-RING ubiquitin ligase complex (IBA,IEA,ISO,ISS) cytoplasm (IBA,IEA,ISO,ISS) desmosome (IEA,ISO,ISS) perikaryon (IEA)
Klhl24 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 11 94,348,024 - 94,382,085 (-) NCBI GRCr8 mRatBN7.2 11 80,843,621 - 80,877,649 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 11 80,846,755 - 80,877,636 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 11 89,566,617 - 89,597,436 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 11 82,219,965 - 82,250,790 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 11 81,281,103 - 81,311,931 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 11 84,613,101 - 84,643,674 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 11 84,615,760 - 84,633,504 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 11 87,675,249 - 87,705,822 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 11 83,094,560 - 83,126,617 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 11 83,152,149 - 83,184,206 (-) NCBI Celera 11 79,681,696 - 79,711,857 (-) NCBI Celera Cytogenetic Map 11 q23 NCBI
KLHL24 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 183,635,623 - 183,684,519 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 183,635,610 - 183,684,519 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 183,353,411 - 183,402,307 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 184,836,105 - 184,885,001 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 3 181,794,950 - 181,843,839 (+) NCBI Celera Cytogenetic Map 3 q27.1 NCBI HuRef 3 180,759,268 - 180,810,190 (+) NCBI HuRef CHM1_1 3 183,317,525 - 183,366,726 (+) NCBI CHM1_1 T2T-CHM13v2.0 3 186,445,098 - 186,493,998 (+) NCBI T2T-CHM13v2.0
Klhl24 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 16 19,916,286 - 19,947,976 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 16 19,916,292 - 19,947,971 (+) Ensembl GRCm39 Ensembl GRCm38 16 20,097,553 - 20,129,226 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 16 20,097,542 - 20,129,221 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 16 20,097,627 - 20,127,817 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 16 20,011,097 - 20,041,287 (+) NCBI MGSCv36 mm8 Celera 16 20,661,389 - 20,691,296 (+) NCBI Celera Cytogenetic Map 16 A3 NCBI cM Map 16 12.36 NCBI
Klhl24 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955420 23,700,035 - 23,735,301 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955420 23,700,030 - 23,733,021 (-) NCBI ChiLan1.0 ChiLan1.0
KLHL24 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 181,505,763 - 181,569,697 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 181,510,545 - 181,574,403 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 180,669,767 - 180,731,186 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 188,837,980 - 188,888,933 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 188,839,457 - 188,885,385 (+) Ensembl panpan1.1 panPan2
KLHL24 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 34 16,583,683 - 16,625,778 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 34 16,590,368 - 16,621,041 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 34 20,671,915 - 20,713,790 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 34 16,491,764 - 16,533,422 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 34 16,491,815 - 16,533,348 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 34 16,530,507 - 16,572,150 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 34 16,517,530 - 16,559,186 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 34 16,755,202 - 16,797,365 (+) NCBI UU_Cfam_GSD_1.0
Klhl24 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 120,024,263 - 120,061,122 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936578 6,116,068 - 6,151,297 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936578 6,116,117 - 6,151,244 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
KLHL24 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 121,570,591 - 121,608,139 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 121,564,833 - 121,608,146 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 131,001,698 - 131,061,043 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
KLHL24 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 15 5,732,347 - 5,780,154 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 15 5,732,928 - 5,780,143 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666063 14,515,358 - 14,565,756 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Klhl24
.
Predicted Target Of
Count of predictions: 94 Count of miRNA genes: 78 Interacting mature miRNAs: 86 Transcripts: ENSRNOT00000052120 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
724554 Iddm17 Insulin dependent diabetes mellitus QTL 17 0.001 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 11 18976208 86241447 Rat 70208 Niddm22 Non-insulin dependent diabetes mellitus QTL 22 3.61 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 11 59802794 82566553 Rat 1581565 Pur10 Proteinuria QTL 10 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 11 44803318 82846466 Rat 634339 Niddm50 Non-insulin dependent diabetes mellitus QTL 50 3.32 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 11 66422148 86241447 Rat 1549848 Bvd6 Brain ventricular dilatation QTL 6 3.1 0.0001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 11 66113321 82169223 Rat 10450831 Scl80 Serum cholesterol level QTL 80 4.7 0.01 blood LDL cholesterol amount (VT:0000181) blood low density lipoprotein cholesterol level (CMO:0000053) 11 76957131 83051965 Rat 10058954 Gmadr7 Adrenal mass QTL 7 2.49 0.0049 adrenal gland mass (VT:0010420) both adrenal glands wet weight to body weight ratio (CMO:0002411) 11 60346590 86241447 Rat 1300135 Rf19 Renal function QTL 19 3.38 blood creatinine amount (VT:0005328) creatinine clearance (CMO:0000765) 11 40946188 82566702 Rat 1354656 Bvd3 Brain ventricular dilatation QTL 3 3.64 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 11 69446070 82846715 Rat 2312566 Glom20 Glomerulus QTL 20 3.6 0.001 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 11 44285759 82566702 Rat 1354593 Stl12 Serum triglyceride level QTL 12 3.36 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 11 66422148 86241447 Rat 724563 Uae10 Urinary albumin excretion QTL 10 6 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 11 27672410 82846715 Rat 724561 Plsm4 Polydactyly-luxate syndrome (PLS) morphotypes QTL 4 0.0003 forelimb integrity trait (VT:0010562) front foot phalanges count (CMO:0001947) 11 54457534 86241447 Rat 4889521 Gluco62 Glucose level QTL 62 2.82 0.001 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 11 55136729 82993457 Rat 7411658 Foco27 Food consumption QTL 27 16.2 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 11 56351424 86241447 Rat 631506 Bp104 Blood pressure QTL 104 2.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 11 59802794 82566545 Rat 1581572 Uae35 Urinary albumin excretion QTL 35 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 11 44803318 82846466 Rat 1300110 Stl7 Serum triglyceride level QTL 7 4.64 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 11 29528418 82566702 Rat
AI104888
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 11 80,873,771 - 80,874,021 (+) MAPPER mRatBN7.2 Rnor_6.0 11 84,639,747 - 84,639,996 NCBI Rnor6.0 Rnor_5.0 11 87,701,895 - 87,702,144 UniSTS Rnor5.0 RGSC_v3.4 11 83,122,223 - 83,122,472 UniSTS RGSC3.4 Celera 11 79,708,017 - 79,708,266 UniSTS RH 3.4 Map 11 686.4 UniSTS Cytogenetic Map 11 q23 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000052120 ⟹ ENSRNOP00000050815
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 11 80,846,755 - 80,877,636 (-) Ensembl Rnor_6.0 Ensembl 11 84,615,760 - 84,633,504 (-) Ensembl
RefSeq Acc Id:
NM_001394229 ⟹ NP_001381158
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,351,157 - 94,382,050 (-) NCBI mRatBN7.2 11 80,846,754 - 80,877,649 (-) NCBI
RefSeq Acc Id:
NM_181473 ⟹ NP_852138
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,351,157 - 94,382,050 (-) NCBI mRatBN7.2 11 80,846,754 - 80,877,649 (-) NCBI Rnor_6.0 11 84,613,101 - 84,643,674 (-) NCBI Rnor_5.0 11 87,675,249 - 87,705,822 (-) NCBI RGSC_v3.4 11 83,094,560 - 83,126,617 (-) RGD Celera 11 79,681,696 - 79,711,857 (-) RGD
Sequence:
GCGAGACTGGTGGTGGCTCCAGGAGACAGCGGCGCTGCAGGGACCGCGGGGGTCGCCGCTCGTGCCGCTTCCAGCCTGCGCCGAGAGCTACATAAAGAAGATCCCTCGGAGCCATTTCTCAACAATTA
hide sequence
RefSeq Acc Id:
XM_039088275 ⟹ XP_038944203
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,998 (-) NCBI mRatBN7.2 11 80,843,621 - 80,876,680 (-) NCBI
RefSeq Acc Id:
XM_039088276 ⟹ XP_038944204
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,374 (-) NCBI mRatBN7.2 11 80,843,621 - 80,876,889 (-) NCBI
RefSeq Acc Id:
XM_063270469 ⟹ XP_063126539
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,998 (-) NCBI
RefSeq Acc Id:
XM_063270470 ⟹ XP_063126540
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,962 (-) NCBI
RefSeq Acc Id:
XM_063270471 ⟹ XP_063126541
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,937 (-) NCBI
RefSeq Acc Id:
XM_063270472 ⟹ XP_063126542
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,382,085 (-) NCBI
RefSeq Acc Id:
XM_063270473 ⟹ XP_063126543
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 11 94,348,024 - 94,381,998 (-) NCBI
RefSeq Acc Id:
NP_852138 ⟸ NM_181473
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
- Sequence:
MVLILGRRLNREDLGVRDSPATKRKVFEMDPKSLTGHEYFDFSSGSSHAENILQIFNEFRDSRLFTDVIICVEGKEFPCHRAVLSACSSYFRAMFCNDHRESREMLVEINGILAEAMECFLQYVYTGK
hide sequence
Ensembl Acc Id:
ENSRNOP00000050815 ⟸ ENSRNOT00000052120
RefSeq Acc Id:
XP_038944204 ⟸ XM_039088276
- Peptide Label:
isoform X1
- UniProtKB:
Q56A24 (UniProtKB/Swiss-Prot), Q812D9 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038944203 ⟸ XM_039088275
- Peptide Label:
isoform X1
- UniProtKB:
Q56A24 (UniProtKB/Swiss-Prot), Q812D9 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001381158 ⟸ NM_001394229
- UniProtKB:
Q56A24 (UniProtKB/Swiss-Prot), Q812D9 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063126542 ⟸ XM_063270472
- Peptide Label:
isoform X1
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063126539 ⟸ XM_063270469
- Peptide Label:
isoform X1
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063126543 ⟸ XM_063270473
- Peptide Label:
isoform X1
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063126540 ⟸ XM_063270470
- Peptide Label:
isoform X1
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063126541 ⟸ XM_063270471
- Peptide Label:
isoform X1
- UniProtKB:
Q812D9 (UniProtKB/Swiss-Prot), Q56A24 (UniProtKB/Swiss-Prot), A6JSC2 (UniProtKB/TrEMBL), F1LNL5 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-02-27
Klhl24
kelch-like family member 24
Klhl24
kelch-like 24 (Drosophila)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-30
Klhl24
kelch-like 24 (Drosophila)
Dre1
Dre1 protein
Symbol and Name updated
1299863 APPROVED
2005-07-08
Dre1
Dre1 protein
Symbol and Name status set to approved
1299863 APPROVED
