Symbol:
Gdf11
Name:
growth differentiation factor 11
RGD ID:
2673
Description:
Predicted to enable cytokine activity. Involved in negative regulation of neuron differentiation. Predicted to be part of protein-containing complex. Predicted to be active in extracellular space. Human ortholog(s) of this gene implicated in vertebral hypersegmentation and orofacial anomalies. Orthologous to human GDF11 (growth differentiation factor 11); INTERACTS WITH 17beta-estradiol; 2,2',4,4'-Tetrabromodiphenyl ether; 2,2',5,5'-tetrachlorobiphenyl.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
BMP-11; bone morphogenetic protein 11; GDF-11; growth/differentiation factor 11
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,896,229 - 1,909,147 (-) NCBI GRCr8 mRatBN7.2 7 1,311,732 - 1,325,211 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 1,311,732 - 1,320,725 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 4,076,094 - 4,085,087 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,951,755 - 5,960,748 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 6,253,020 - 6,262,013 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 3,306,863 - 3,315,856 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 3,306,863 - 3,315,856 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 3,277,923 - 3,286,916 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 2,182,467 - 2,191,454 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 2,185,253 - 2,191,265 (-) NCBI Celera 7 1,182,487 - 1,191,452 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gdf11 Rat 17beta-estradiol multiple interactions ISO GDF11 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in increased expression of GDF11 mRNA CTD PMID:30165855 Gdf11 Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of GDF11 mRNA CTD PMID:32145629 Gdf11 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:31826744 Gdf11 Rat 2,2',5,5'-tetrachlorobiphenyl increases expression EXP 6480464 2 more ... CTD PMID:23829299 Gdf11 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Gdf11 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of GDF11 mRNA CTD PMID:26377647 Gdf11 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of GDF11 mRNA CTD PMID:33387578 Gdf11 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of GDF11 mRNA CTD PMID:32109520 Gdf11 Rat 2-amino-2-deoxy-D-galactopyranose multiple interactions ISO Gdf11 (Mus musculus) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one affects the reaction [GDF11 protein affects the reaction [[Galactosamine co-treated with lipopolysaccharide more ... CTD PMID:37934488 Gdf11 Rat 5-aza-2'-deoxycytidine increases expression ISO Gdf11 (Mus musculus) 6480464 Decitabine results in increased expression of GDF11 mRNA CTD PMID:27915011 Gdf11 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of GDF11 mRNA CTD PMID:24780913 and PMID:30047161 Gdf11 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of GDF11 mRNA CTD PMID:28959563 Gdf11 Rat acrylamide decreases expression ISO GDF11 (Homo sapiens) 6480464 Acrylamide results in decreased expression of GDF11 mRNA CTD PMID:32763439 Gdf11 Rat all-trans-retinoic acid increases expression ISO GDF11 (Homo sapiens) 6480464 Tretinoin results in increased expression of GDF11 mRNA CTD PMID:17196394 Gdf11 Rat all-trans-retinoic acid decreases expression ISO GDF11 (Homo sapiens) 6480464 Tretinoin results in decreased expression of GDF11 mRNA CTD PMID:33167477 Gdf11 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of GDF11 mRNA CTD PMID:16483693 Gdf11 Rat aristolochic acid A decreases expression ISO GDF11 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of GDF11 mRNA CTD PMID:33212167 Gdf11 Rat benzo[a]pyrene increases expression ISO GDF11 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of GDF11 mRNA CTD PMID:32234424 Gdf11 Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of GDF11 mRNA CTD PMID:18164116 Gdf11 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of GDF11 mRNA CTD PMID:25181051 and PMID:30816183 Gdf11 Rat bisphenol A increases expression ISO GDF11 (Homo sapiens) 6480464 bisphenol A results in increased expression of GDF11 protein CTD PMID:33376534 Gdf11 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of GDF11 mRNA CTD PMID:32145629 Gdf11 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of GDF11 gene CTD PMID:28505145 Gdf11 Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of GDF11 mRNA CTD PMID:33453195 Gdf11 Rat clobetasol decreases expression ISO Gdf11 (Mus musculus) 6480464 Clobetasol results in decreased expression of GDF11 mRNA CTD PMID:27462272 Gdf11 Rat cobalt dichloride decreases expression EXP 6480464 cobaltous chloride results in decreased expression of GDF11 mRNA CTD PMID:24386269 Gdf11 Rat copper atom increases expression EXP 6480464 Copper results in increased expression of GDF11 mRNA CTD PMID:30556269 Gdf11 Rat copper(0) increases expression EXP 6480464 Copper results in increased expression of GDF11 mRNA CTD PMID:30556269 Gdf11 Rat corosolic acid multiple interactions ISO Gdf11 (Mus musculus) 6480464 corosolic acid inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of GDF11 mRNA] CTD PMID:32135139 Gdf11 Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of GDF11 mRNA CTD PMID:27523638 Gdf11 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of GDF11 mRNA CTD PMID:21551480 Gdf11 Rat doxorubicin decreases expression ISO GDF11 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of GDF11 mRNA CTD PMID:29803840 Gdf11 Rat ethanol increases expression ISO Gdf11 (Mus musculus) 6480464 Ethanol results in increased expression of GDF11 mRNA CTD PMID:30319688 Gdf11 Rat folic acid increases expression ISO Gdf11 (Mus musculus) 6480464 Folic Acid results in increased expression of GDF11 mRNA CTD PMID:25629700 Gdf11 Rat furan increases expression EXP 6480464 furan results in increased expression of GDF11 mRNA CTD PMID:25539665 Gdf11 Rat graphite affects expression EXP 6480464 Graphite affects the expression of GDF11 mRNA CTD PMID:29933104 Gdf11 Rat hydrogen sulfide multiple interactions ISO Gdf11 (Mus musculus) 6480464 GDF11 protein inhibits the reaction [Hydrogen Sulfide inhibits the reaction [paraform results in decreased expression of SQSTM1 protein]] CTD PMID:37105376 Gdf11 Rat isoflurane decreases methylation ISO Gdf11 (Mus musculus) 6480464 Isoflurane results in decreased methylation of GDF11 mRNA CTD PMID:35249202 Gdf11 Rat LY294002 multiple interactions ISO Gdf11 (Mus musculus) 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one affects the reaction [GDF11 protein affects the reaction [[Galactosamine co-treated with lipopolysaccharide more ... CTD PMID:37934488 Gdf11 Rat maneb multiple interactions ISO Gdf11 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of GDF11 mRNA CTD PMID:36117858 Gdf11 Rat methimazole decreases expression EXP 6480464 Methimazole results in decreased expression of GDF11 mRNA CTD PMID:30047161 Gdf11 Rat methyl methanesulfonate decreases expression ISO GDF11 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of GDF11 mRNA CTD PMID:23649840 Gdf11 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of GDF11 mRNA CTD PMID:18164116 Gdf11 Rat N-Nitrosopyrrolidine increases expression ISO GDF11 (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in increased expression of GDF11 mRNA CTD PMID:32234424 Gdf11 Rat O-methyleugenol increases expression ISO GDF11 (Homo sapiens) 6480464 methyleugenol results in increased expression of GDF11 mRNA CTD PMID:32234424 Gdf11 Rat orphenadrine affects expression EXP 6480464 Orphenadrine affects the expression of GDF11 mRNA CTD PMID:23665939 Gdf11 Rat paracetamol affects expression ISO Gdf11 (Mus musculus) 6480464 Acetaminophen affects the expression of GDF11 mRNA CTD PMID:17562736 Gdf11 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of GDF11 mRNA CTD PMID:33387578 Gdf11 Rat paracetamol increases expression ISO GDF11 (Homo sapiens) 6480464 Acetaminophen results in increased expression of GDF11 mRNA CTD PMID:29067470 Gdf11 Rat paraformaldehyde macromolecule multiple interactions ISO Gdf11 (Mus musculus) 6480464 GDF11 protein inhibits the reaction [Hydrogen Sulfide inhibits the reaction [paraform results in decreased expression of SQSTM1 protein]] more ... CTD PMID:37105376 Gdf11 Rat paraformaldehyde macromolecule increases expression ISO Gdf11 (Mus musculus) 6480464 paraform results in increased expression of GDF11 protein CTD PMID:37105376 Gdf11 Rat paraquat multiple interactions ISO Gdf11 (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of GDF11 mRNA CTD PMID:36117858 Gdf11 Rat PCB138 decreases expression EXP 6480464 2 more ... CTD PMID:23829299 Gdf11 Rat phorbol 13-acetate 12-myristate multiple interactions ISO Gdf11 (Mus musculus) 6480464 corosolic acid inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of GDF11 mRNA] CTD PMID:32135139 Gdf11 Rat phorbol 13-acetate 12-myristate increases expression ISO Gdf11 (Mus musculus) 6480464 Tetradecanoylphorbol Acetate results in increased expression of GDF11 mRNA CTD PMID:32135139 Gdf11 Rat propanal increases expression ISO GDF11 (Homo sapiens) 6480464 propionaldehyde results in increased expression of GDF11 mRNA CTD PMID:26079696 Gdf11 Rat quercetin increases expression ISO GDF11 (Homo sapiens) 6480464 Quercetin results in increased expression of GDF11 mRNA CTD PMID:21632981 Gdf11 Rat sevoflurane decreases methylation ISO Gdf11 (Mus musculus) 6480464 Sevoflurane results in decreased methylation of GDF11 mRNA CTD PMID:35249202 Gdf11 Rat silicon dioxide increases expression ISO Gdf11 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of GDF11 mRNA CTD PMID:29341224 Gdf11 Rat sulfadimethoxine decreases expression EXP 6480464 Sulfadimethoxine results in decreased expression of GDF11 mRNA CTD PMID:30047161 Gdf11 Rat sulforaphane decreases expression ISO GDF11 (Homo sapiens) 6480464 sulforaphane results in decreased expression of GDF11 mRNA CTD PMID:31838189 Gdf11 Rat sunitinib decreases expression ISO GDF11 (Homo sapiens) 6480464 Sunitinib results in decreased expression of GDF11 mRNA CTD PMID:31533062 Gdf11 Rat titanium dioxide decreases methylation ISO Gdf11 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of GDF11 gene CTD PMID:35295148 Gdf11 Rat trichostatin A affects expression ISO GDF11 (Homo sapiens) 6480464 trichostatin A affects the expression of GDF11 mRNA CTD PMID:28542535 Gdf11 Rat triphenyl phosphate affects expression ISO GDF11 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of GDF11 mRNA CTD PMID:37042841 Gdf11 Rat valproic acid increases expression ISO GDF11 (Homo sapiens) 6480464 Valproic Acid results in increased expression of GDF11 mRNA CTD PMID:29154799
17beta-estradiol (EXP,ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2-amino-2-deoxy-D-galactopyranose (ISO) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) acrylamide (EXP,ISO) all-trans-retinoic acid (ISO) ammonium chloride (EXP) aristolochic acid A (ISO) benzo[a]pyrene (ISO) beta-naphthoflavone (EXP) bisphenol A (EXP,ISO) cadmium dichloride (EXP) clobetasol (ISO) cobalt dichloride (EXP) copper atom (EXP) copper(0) (EXP) corosolic acid (ISO) Cuprizon (EXP) diuron (EXP) doxorubicin (ISO) ethanol (ISO) folic acid (ISO) furan (EXP) graphite (EXP) hydrogen sulfide (ISO) isoflurane (ISO) LY294002 (ISO) maneb (ISO) methimazole (EXP) methyl methanesulfonate (ISO) N-nitrosodiethylamine (EXP) N-Nitrosopyrrolidine (ISO) O-methyleugenol (ISO) orphenadrine (EXP) paracetamol (EXP,ISO) paraformaldehyde macromolecule (ISO) paraquat (ISO) PCB138 (EXP) phorbol 13-acetate 12-myristate (ISO) propanal (ISO) quercetin (ISO) sevoflurane (ISO) silicon dioxide (ISO) sulfadimethoxine (EXP) sulforaphane (ISO) sunitinib (ISO) titanium dioxide (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) valproic acid (ISO)
Biological Process
activin receptor signaling pathway (IEA,ISO) amacrine cell differentiation (IEA,ISO) animal organ morphogenesis (IEA,ISO) anterior/posterior pattern specification (IEA,ISO) camera-type eye morphogenesis (IEA,ISO) cell population proliferation (IEA,ISO) metanephros development (IEA,ISO) negative regulation of amacrine cell differentiation (IEA,ISO) negative regulation of cell population proliferation (IEA,ISO) negative regulation of neuron differentiation (IEA,IMP,ISO) neuron differentiation (IEA,ISO) pancreas development (IEA,ISO) positive regulation of SMAD protein signal transduction (IEA,ISO,ISS) roof of mouth development (IEA,ISO) skeletal system development (IEA,ISO) spinal cord anterior/posterior patterning (IEA,ISO) type B pancreatic cell maturation (IEA,ISO) ureteric bud development (IEA,ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
GDF11 forms a bone morphogenetic protein 1-activated latent complex that can modulate nerve growth factor-induced differentiation of PC12 cells.
Ge G, etal., Mol Cell Biol. 2005 Jul;25(14):5846-58.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Systemic Blockade of ACVR2B Ligands Protects Myocardium from Acute Ischemia-Reperfusion Injury.
Magga J, etal., Mol Ther. 2019 Mar 6;27(3):600-610. doi: 10.1016/j.ymthe.2019.01.013. Epub 2019 Jan 24.
5.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
6.
Expression of growth/differentiation factor 11, a new member of the BMP/TGFbeta superfamily during mouse embryogenesis.
Nakashima M, etal., Mech Dev 1999 Feb;80(2):185-9.
7.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
8.
Online Mendelian Inheritance in Man, OMIM (TM).
Online Mendelian Inheritance in Man, OMIM (TM).
9.
GOA pipeline
RGD automated data pipeline
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
Comprehensive gene review and curation
RGD comprehensive gene curation
12.
Tentative Sequence Identification Numbers
Tentative Sequence Data IDs. TIGR Gene Index, Rat Data
Gdf11 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,896,229 - 1,909,147 (-) NCBI GRCr8 mRatBN7.2 7 1,311,732 - 1,325,211 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 1,311,732 - 1,320,725 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 4,076,094 - 4,085,087 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,951,755 - 5,960,748 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 6,253,020 - 6,262,013 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 3,306,863 - 3,315,856 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 3,306,863 - 3,315,856 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 3,277,923 - 3,286,916 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 2,182,467 - 2,191,454 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 2,185,253 - 2,191,265 (-) NCBI Celera 7 1,182,487 - 1,191,452 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
GDF11 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 55,743,122 - 55,757,264 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 55,743,122 - 55,757,264 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 56,136,906 - 56,151,048 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 54,423,331 - 54,430,332 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 54,423,333 - 54,430,332 NCBI Celera 12 55,789,534 - 55,799,135 (+) NCBI Celera Cytogenetic Map 12 q13.2 NCBI HuRef 12 53,175,916 - 53,185,626 (+) NCBI HuRef CHM1_1 12 56,103,813 - 56,113,414 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 55,709,757 - 55,723,906 (+) NCBI T2T-CHM13v2.0
Gdf11 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 128,716,393 - 128,727,587 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 128,718,164 - 128,727,587 (-) Ensembl GRCm39 Ensembl GRCm38 10 128,880,524 - 128,891,718 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 128,882,295 - 128,891,718 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 128,321,602 - 128,328,774 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 128,287,495 - 128,294,634 (-) NCBI MGSCv36 mm8 Celera 10 131,277,119 - 131,314,308 (-) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 77.18 NCBI
Gdf11 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955458 3,388,402 - 3,398,040 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955458 3,388,402 - 3,398,040 (+) NCBI ChiLan1.0 ChiLan1.0
GDF11 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 38,571,240 - 38,585,080 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 38,568,010 - 38,581,811 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 33,154,530 - 33,168,427 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 33,879,143 - 33,893,027 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 33,879,180 - 33,893,252 (-) Ensembl panpan1.1 panPan2
GDF11 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 142,039 - 152,537 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 145,036 - 148,373 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 202,146 - 211,966 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 147,013 - 159,810 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 147,013 - 153,803 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 124,694 - 137,481 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 367,790 - 377,596 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 491,709 - 504,497 (+) NCBI UU_Cfam_GSD_1.0
Gdf11
GDF11 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 21,191,251 - 21,201,804 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 21,191,322 - 21,199,024 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 22,671,244 - 22,678,880 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
GDF11 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 51,693,664 - 51,702,781 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 51,693,717 - 51,700,278 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 194,292,055 - 194,300,722 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Gdf11
.
Predicted Target Of
Count of predictions: 43 Count of miRNA genes: 39 Interacting mature miRNAs: 42 Transcripts: ENSRNOT00000010035 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61410 Bw19 Body weight QTL 19 6.2 0.001 body mass (VT:0001259) body weight (CMO:0000012) 7 1 44782185 Rat 1300176 Hrtrt10 Heart rate QTL 10 3.19 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 7 664270 26029351 Rat 2317047 Wbc4 White blood cell count QTL 4 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 7 1 35342956 Rat 2298550 Neuinf6 Neuroinflammation QTL 6 3.3 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 7 1 27829089 Rat 631503 Bp102 Blood pressure QTL 102 1.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 1 44822433 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 724560 Plsm3 Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 0.0003 tibia length (VT:0004357) tibia length (CMO:0000450) 7 1 34000259 Rat 9590142 Scort5 Serum corticosterone level QTL 5 24.4 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 1 31962314 Rat 7411566 Bw136 Body weight QTL 136 10.4 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 1 31962314 Rat
MARC_41381-41054:1084804684:3
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 1,320,288 - 1,320,701 (+) MAPPER mRatBN7.2 Rnor_6.0 7 3,315,420 - 3,315,832 NCBI Rnor6.0 Rnor_5.0 7 3,286,480 - 3,286,892 UniSTS Rnor5.0 RGSC_v3.4 7 2,191,024 - 2,191,436 UniSTS RGSC3.4 Cytogenetic Map 7 q11 UniSTS
Gdf11
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 1,314,728 - 1,315,838 (+) MAPPER mRatBN7.2 Rnor_6.0 7 3,309,860 - 3,310,969 NCBI Rnor6.0 Rnor_5.0 7 3,280,920 - 3,282,029 UniSTS Rnor5.0 RGSC_v3.4 7 2,185,464 - 2,186,573 UniSTS RGSC3.4 Celera 7 1,185,484 - 1,186,593 UniSTS Cytogenetic Map 7 q11 UniSTS
UniSTS:498329
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 1,320,257 - 1,320,416 (+) MAPPER mRatBN7.2 Rnor_6.0 7 3,315,389 - 3,315,547 NCBI Rnor6.0 Rnor_5.0 7 3,286,449 - 3,286,607 UniSTS Rnor5.0 RGSC_v3.4 7 2,190,993 - 2,191,151 UniSTS RGSC3.4 Celera 7 1,191,013 - 1,191,171 UniSTS Cytogenetic Map 7 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000010035 ⟹ ENSRNOP00000010035
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 1,311,732 - 1,320,725 (-) Ensembl Rnor_6.0 Ensembl 7 3,306,863 - 3,315,856 (-) Ensembl
RefSeq Acc Id:
NM_017203 ⟹ NP_058899
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 1,896,229 - 1,905,222 (-) NCBI mRatBN7.2 7 1,311,732 - 1,320,725 (-) NCBI Rnor_6.0 7 3,306,863 - 3,315,856 (-) NCBI Rnor_5.0 7 3,277,923 - 3,286,916 (-) NCBI Celera 7 1,182,487 - 1,191,452 (-) NCBI
Sequence:
TCCCCGCCCCCCAGTCCTCCCCTCCCCTGCAGCATGGTGCTCGCGGCCCCGCTGCTGCTGGGCTTCCTGCTCCTCGCCCTGGAGCTGCGGCCCCGGGGGGAGGCGGCCGAGGGCCCCGCGGCGGCGGC
hide sequence
RefSeq Acc Id:
XM_039078581 ⟹ XP_038934509
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 1,896,231 - 1,909,147 (-) NCBI mRatBN7.2 7 1,311,734 - 1,324,962 (-) NCBI
RefSeq Acc Id:
NP_058899 ⟸ NM_017203
- Peptide Label:
precursor
- UniProtKB:
G3V6Y2 (UniProtKB/Swiss-Prot), Q9Z217 (UniProtKB/Swiss-Prot)
- Sequence:
MVLAAPLLLGFLLLALELRPRGEAAEGPAAAAAAAAAAAGVGGERSSRPAPSAAPEPDGCPVCVWRQHSRELRLESIKSQILSKLRLKEAPNISREVVKQLLPKAPPLQQILDLHDFQGDALQPEDFL
hide sequence
Ensembl Acc Id:
ENSRNOP00000010035 ⟸ ENSRNOT00000010035
RefSeq Acc Id:
XP_038934509 ⟸ XM_039078581
- Peptide Label:
isoform X1
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2002-06-10
Gdf11
growth differentiation factor 11
Name updated
70584 APPROVED
Note Type
Note
Reference
gene_expression
expressed in adult dental pulp and brain
69843
gene_product
member of the bone morphogenetic protein/transforming growth factor beta (BMP/TGFbeta) superfamily
69843
