Symbol:
Tonsl
Name:
tonsoku-like, DNA repair protein
RGD ID:
1307483
Description:
Predicted to enable histone binding activity and histone reader activity. Predicted to be involved in double-strand break repair via homologous recombination; protein localization to chromatin; and replication fork processing. Predicted to be located in nuclear body. Predicted to be part of DNA replication factor A complex; FACT complex; and MCM complex. Predicted to be active in nuclear replication fork and site of double-strand break. Human ortholog(s) of this gene implicated in spondyloepimetaphyseal dysplasia, Sponastrime type. Orthologous to human TONSL (tonsoku like, DNA repair protein); INTERACTS WITH 1-naphthyl isothiocyanate; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
I-kappa-B-related protein; ikappaBR; inhibitor of kappa B-related protein; LOC366953; NF-kappa-B inhibitor-like protein 2; Nfkbil2; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2; tonsoku-like protein
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TONSL (tonsoku like, DNA repair protein) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tonsl (tonsoku-like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tonsl (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TONSL (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TONSL (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tonsl (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TONSL (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TONSL (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tonsl (tonsoku like, DNA repair protein) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
TRPM5 (transient receptor potential cation channel subfamily M member 5) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
TONSL (tonsoku like, DNA repair protein)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tonsl (tonsoku-like, DNA repair protein)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tonsl (tonsoku-like, DNA repair protein)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
K02B12.5
Alliance
DIOPT (Hieranoid|InParanoid|OrthoInspector)
Drosophila melanogaster (fruit fly):
CG7457
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tonsl
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 110,226,696 - 110,241,459 (-) NCBI GRCr8 mRatBN7.2 7 108,345,704 - 108,360,792 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 108,346,047 - 108,360,750 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 110,087,909 - 110,102,598 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 112,311,483 - 112,326,174 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 112,272,312 - 112,287,018 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 117,688,397 - 117,703,139 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 117,688,397 - 117,703,094 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 117,676,480 - 117,691,180 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 114,674,549 - 114,689,284 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 114,708,853 - 114,723,447 (-) NCBI Celera 7 104,696,209 - 104,710,912 (-) NCBI Celera Cytogenetic Map 7 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tonsl Rat 1,2-dimethylhydrazine multiple interactions ISO RGD:1614311 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TONSL mRNA CTD PMID:22206623 Tonsl Rat 1-(5-isoquinolinesulfonyl)-2-methylpiperazine multiple interactions ISO RGD:1614311 6480464 [TNF protein co-treated with 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine] results in increased activity of NFKB protein CTD PMID:14654170 Tonsl Rat 1-naphthyl isothiocyanate increases expression EXP 6480464 1-Naphthylisothiocyanate results in increased expression of TONSL mRNA CTD PMID:30723492 Tonsl Rat 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in increased expression of TONSL mRNA CTD PMID:26496021 Tonsl Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TONSL mRNA CTD PMID:32145629 Tonsl Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of TONSL mRNA CTD PMID:22298810 Tonsl Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1316704 6480464 Tetrachlorodibenzodioxin results in decreased expression of TONSL mRNA CTD PMID:29704546 Tonsl Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:1316704 6480464 [Tetrachlorodibenzodioxin co-treated with 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide] results in decreased expression of TONSL mRNA CTD PMID:29704546 Tonsl Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1614311 6480464 Tetrachlorodibenzodioxin affects the expression of TONSL mRNA CTD PMID:24680724 Tonsl Rat 3,4-methylenedioxymethamphetamine decreases expression ISO RGD:1614311 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of TONSL mRNA CTD PMID:20188158 Tonsl Rat 4,4'-sulfonyldiphenol decreases methylation ISO RGD:1614311 6480464 bisphenol S results in decreased methylation of TONSL exon CTD PMID:33297965 Tonsl Rat 5-(2-methylpiperazine-1-sulfonyl)isoquinoline multiple interactions ISO RGD:1614311 6480464 [TNF protein co-treated with 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine] results in increased activity of NFKB protein CTD PMID:14654170 Tonsl Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of TONSL mRNA CTD PMID:24780913 Tonsl Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of TONSL mRNA CTD PMID:31881176 Tonsl Rat acrylamide decreases expression ISO RGD:1316704 6480464 Acrylamide results in decreased expression of TONSL mRNA CTD PMID:32763439 Tonsl Rat aflatoxin B1 increases methylation ISO RGD:1316704 6480464 Aflatoxin B1 results in increased methylation of TONSL gene CTD PMID:27153756 Tonsl Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of TONSL mRNA CTD PMID:30047161 Tonsl Rat aristolochic acid A increases expression ISO RGD:1316704 6480464 aristolochic acid I results in increased expression of TONSL mRNA CTD PMID:33212167 Tonsl Rat arsane affects methylation ISO RGD:1316704 6480464 Arsenic affects the methylation of TONSL gene CTD PMID:25304211 Tonsl Rat arsenic atom affects methylation ISO RGD:1316704 6480464 Arsenic affects the methylation of TONSL gene CTD PMID:25304211 Tonsl Rat arsenite(3-) multiple interactions ISO RGD:1316704 6480464 arsenite inhibits the reaction [G3BP1 protein binds to TONSL mRNA] CTD PMID:32406909 Tonsl Rat benzo[a]pyrene increases expression ISO RGD:1316704 6480464 Benzo(a)pyrene results in increased expression of TONSL mRNA CTD PMID:32234424 Tonsl Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in increased expression of TONSL mRNA CTD PMID:26496021 Tonsl Rat bisphenol A decreases expression ISO RGD:1614311 6480464 bisphenol A results in decreased expression of TONSL mRNA CTD PMID:38074096 Tonsl Rat bisphenol A decreases methylation ISO RGD:1316704 6480464 bisphenol A results in decreased methylation of TONSL gene CTD PMID:31601247 Tonsl Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of TONSL mRNA CTD PMID:32145629 Tonsl Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TONSL mRNA CTD PMID:25181051 Tonsl Rat bisphenol F decreases expression ISO RGD:1614311 6480464 bisphenol F results in decreased expression of TONSL mRNA CTD PMID:38685157 Tonsl Rat bromobenzene decreases expression EXP 6480464 bromobenzene results in decreased expression of TONSL mRNA CTD PMID:32479839 Tonsl Rat calcitriol decreases expression ISO RGD:1316704 6480464 Calcitriol results in decreased expression of TONSL mRNA CTD PMID:21592394 Tonsl Rat calcitriol multiple interactions ISO RGD:1316704 6480464 [Testosterone co-treated with Calcitriol] results in decreased expression of TONSL mRNA CTD PMID:21592394 Tonsl Rat carbon nanotube increases expression ISO RGD:1614311 6480464 Nanotubes, Carbon analog results in increased expression of TONSL mRNA; Nanotubes, Carbon results in increased more ... CTD PMID:25554681 Tonsl Rat carbon nanotube decreases expression ISO RGD:1614311 6480464 Nanotubes, Carbon results in decreased expression of TONSL mRNA CTD PMID:25620056 Tonsl Rat cefaloridine increases expression EXP 6480464 Cephaloridine results in increased expression of TONSL mRNA CTD PMID:18500788 Tonsl Rat chlorpyrifos decreases expression ISO RGD:1614311 6480464 Chlorpyrifos results in decreased expression of TONSL mRNA CTD PMID:37019170 Tonsl Rat chromium(6+) multiple interactions ISO RGD:1316704 6480464 [zinc chromate results in increased abundance of chromium hexavalent ion] which results in decreased expression more ... CTD PMID:38479592 Tonsl Rat copper(II) sulfate decreases expression ISO RGD:1316704 6480464 Copper Sulfate results in decreased expression of TONSL mRNA CTD PMID:19549813 Tonsl Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of TONSL mRNA CTD PMID:26577399 Tonsl Rat DDE increases expression ISO RGD:1316704 6480464 Dichlorodiphenyl Dichloroethylene results in increased expression of TONSL mRNA CTD PMID:38568856 Tonsl Rat Dibutyl phosphate affects expression ISO RGD:1316704 6480464 di-n-butylphosphoric acid affects the expression of TONSL mRNA CTD PMID:37042841 Tonsl Rat dicrotophos increases expression ISO RGD:1316704 6480464 dicrotophos results in increased expression of TONSL mRNA CTD PMID:28302478 Tonsl Rat dioxygen decreases expression ISO RGD:1316704 6480464 Oxygen deficiency results in decreased expression of TONSL mRNA CTD PMID:26516004 Tonsl Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of TONSL mRNA CTD PMID:29391264 Tonsl Rat ethanol affects expression ISO RGD:1614311 6480464 Ethanol affects the expression of TONSL mRNA CTD PMID:30319688 Tonsl Rat folic acid multiple interactions ISO RGD:1614311 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TONSL mRNA CTD PMID:22206623 Tonsl Rat FR900359 increases phosphorylation ISO RGD:1316704 6480464 FR900359 results in increased phosphorylation of TONSL protein CTD PMID:37730182 Tonsl Rat furan increases expression EXP 6480464 furan results in increased expression of TONSL mRNA CTD PMID:25539665 Tonsl Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of TONSL mRNA CTD PMID:33387578 Tonsl Rat okadaic acid increases expression ISO RGD:1316704 6480464 Okadaic Acid results in increased expression of TONSL mRNA CTD PMID:38832940 Tonsl Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of TONSL mRNA CTD PMID:33387578 Tonsl Rat paraquat decreases expression EXP 6480464 Paraquat results in decreased expression of TONSL mRNA CTD PMID:32680482 Tonsl Rat quercetin increases expression ISO RGD:1316704 6480464 Quercetin results in increased expression of TONSL mRNA CTD PMID:21632981 Tonsl Rat sodium arsenite decreases expression ISO RGD:1316704 6480464 sodium arsenite results in decreased expression of TONSL mRNA CTD PMID:38568856 Tonsl Rat sodium arsenite increases expression ISO RGD:1316704 6480464 sodium arsenite results in increased expression of TONSL mRNA CTD PMID:34032870 Tonsl Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of TONSL mRNA CTD PMID:30047161 Tonsl Rat sunitinib decreases expression ISO RGD:1316704 6480464 Sunitinib results in decreased expression of TONSL mRNA CTD PMID:31533062 Tonsl Rat testosterone multiple interactions ISO RGD:1316704 6480464 [Testosterone co-treated with Calcitriol] results in decreased expression of TONSL mRNA CTD PMID:21592394 Tonsl Rat testosterone decreases expression ISO RGD:1316704 6480464 Testosterone results in decreased expression of TONSL mRNA CTD PMID:21592394 Tonsl Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of TONSL mRNA CTD PMID:23411599|PMID:34492290 Tonsl Rat titanium dioxide increases expression ISO RGD:1614311 6480464 titanium dioxide results in increased expression of TONSL mRNA CTD PMID:23557971 Tonsl Rat titanium dioxide increases methylation ISO RGD:1614311 6480464 titanium dioxide results in increased methylation of TONSL gene CTD PMID:35295148 Tonsl Rat titanium dioxide decreases methylation ISO RGD:1614311 6480464 titanium dioxide results in decreased methylation of TONSL promoter CTD PMID:35295148 Tonsl Rat trimellitic anhydride increases expression ISO RGD:1614311 6480464 trimellitic anhydride results in increased expression of TONSL mRNA CTD PMID:19042947 Tonsl Rat triptonide increases expression ISO RGD:1614311 6480464 triptonide results in increased expression of TONSL mRNA CTD PMID:33045310 Tonsl Rat urethane decreases expression ISO RGD:1316704 6480464 Urethane results in decreased expression of TONSL mRNA CTD PMID:28818685 Tonsl Rat valproic acid increases methylation ISO RGD:1316704 6480464 Valproic Acid results in increased methylation of TONSL gene CTD PMID:29154799 Tonsl Rat valproic acid affects expression ISO RGD:1316704 6480464 Valproic Acid affects the expression of TONSL mRNA CTD PMID:25979313 Tonsl Rat valproic acid decreases expression ISO RGD:1316704 6480464 Valproic Acid results in decreased expression of TONSL mRNA CTD PMID:28001369
Cellular Component
chromosome (IEA) cytoplasm (IEA) DNA replication factor A complex (IEA,ISO,ISS) FACT complex (IEA,ISO,ISS) MCM complex (IEA,ISO,ISS) nuclear body (IEA,ISO) nuclear replication fork (IBA,IEA,ISO,ISS) nucleoplasm (IEA,ISO) nucleus (IEA) site of double-strand break (IEA,ISO,ISS)
Tonsl Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 110,226,696 - 110,241,459 (-) NCBI GRCr8 mRatBN7.2 7 108,345,704 - 108,360,792 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 108,346,047 - 108,360,750 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 110,087,909 - 110,102,598 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 112,311,483 - 112,326,174 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 112,272,312 - 112,287,018 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 117,688,397 - 117,703,139 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 117,688,397 - 117,703,094 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 117,676,480 - 117,691,180 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 114,674,549 - 114,689,284 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 114,708,853 - 114,723,447 (-) NCBI Celera 7 104,696,209 - 104,710,912 (-) NCBI Celera Cytogenetic Map 7 q34 NCBI
TONSL Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 144,428,775 - 144,444,440 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 144,428,775 - 144,444,440 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 145,654,158 - 145,669,823 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 145,624,984 - 145,640,589 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 145,624,998 - 145,640,589 NCBI Celera 8 141,828,598 - 141,844,246 (-) NCBI Celera Cytogenetic Map 8 q24.3 NCBI HuRef 8 140,767,398 - 140,783,046 (-) NCBI HuRef CHM1_1 8 145,692,404 - 145,708,053 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 145,598,589 - 145,614,253 (-) NCBI T2T-CHM13v2.0
Tonsl Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 76,510,437 - 76,524,129 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 76,510,202 - 76,524,158 (-) Ensembl GRCm39 Ensembl GRCm38 15 76,626,237 - 76,639,929 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 76,626,002 - 76,639,958 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 76,456,667 - 76,470,359 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 76,453,492 - 76,467,166 (-) NCBI MGSCv36 mm8 Celera 15 78,119,844 - 78,133,536 (-) NCBI Celera Cytogenetic Map 15 D3 NCBI cM Map 15 36.18 NCBI
Tonsl Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955454 3,054,400 - 3,068,028 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955454 3,054,727 - 3,067,785 (-) NCBI ChiLan1.0 ChiLan1.0
TONSL Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 161,920,096 - 161,936,289 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 137,449,461 - 137,465,352 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 141,195,959 - 141,211,849 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 144,185,674 - 144,200,930 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 144,185,674 - 144,201,040 (-) Ensembl panpan1.1 panPan2
TONSL Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 13 37,846,010 - 37,857,633 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 13 37,846,149 - 37,857,668 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 13 37,807,109 - 37,818,700 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 13 38,320,076 - 38,331,667 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 13 38,320,131 - 38,331,728 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 13 38,011,918 - 38,023,454 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 13 38,120,565 - 38,132,086 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 13 38,596,909 - 38,608,509 (-) NCBI UU_Cfam_GSD_1.0
Tonsl
TONSL
TONSL Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 138,641,514 - 138,657,429 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 138,641,575 - 138,656,673 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666039 1,199,538 - 1,214,793 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tonsl
.
Predicted Target Of
Count of predictions: 41 Count of miRNA genes: 40 Interacting mature miRNAs: 41 Transcripts: ENSRNOT00000019754 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1300179 Kidm5 Kidney mass QTL 5 3.51 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 43747012 135012528 Rat 1331728 Bp214 Blood pressure QTL 214 2.825 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 80221299 124373579 Rat 1331731 Bp216 Blood pressure QTL 216 2.851 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 102297359 133492884 Rat 2298475 Eau6 Experimental allergic uveoretinitis QTL 6 0.0029 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 7 84257275 129257275 Rat 71114 Niddm14 Non-insulin dependent diabetes mellitus QTL 14 4.5 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 7 84257275 129257275 Rat 1357336 Gluco6 Glucose level QTL 6 3.4 blood glucose amount (VT:0000188) serum glucose level (CMO:0000543) 7 94811326 116294265 Rat 1358361 Sradr5 Stress Responsive Adrenal Weight QTL 5 5.55 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 7 43747012 108555253 Rat 1357338 Stl17 Serum triglyceride level QTL 17 3.23 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 7 69736356 112729554 Rat 631687 Hcas1 Hepatocarcinoma susceptibility QTL 1 3.9 0.001 liver integrity trait (VT:0010547) liver tumorous lesion volume to total liver volume ratio (CMO:0001082) 7 91412594 129807172 Rat 70159 Bp61 Blood pressure QTL 61 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 103146217 116738842 Rat 634331 Pia17 Pristane induced arthritis QTL 17 4.7 joint integrity trait (VT:0010548) arthritic paw count (CMO:0001460) 7 73829340 130221005 Rat 1358914 Bp266 Blood pressure QTL 266 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 83591953 134666232 Rat 631504 Cm27 Cardiac mass QTL 27 3.45 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 7 44421311 118198041 Rat 634322 Bw12 Body weight QTL 12 0 body mass (VT:0001259) body weight (CMO:0000012) 7 83153392 128153392 Rat 70173 Niddm19 Non-insulin dependent diabetes mellitus QTL 19 4.33 0.00005 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 7 64002457 135012528 Rat 1549899 Stresp8 Stress response QTL 8 4.37 0.0008 stress-related behavior trait (VT:0010451) defensive burying duration (CMO:0001961) 7 90482196 135012528 Rat 2317052 Aia17 Adjuvant induced arthritis QTL 17 2.13 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 7 81737938 126737938 Rat 631529 Tls2 T-lymphoma susceptibility QTL 2 0 0.001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 7 80221299 109401111 Rat 731176 Glom5 Glomerulus QTL 5 2.5 0.0035 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) 7 96670164 135012528 Rat 7411607 Foco15 Food consumption QTL 15 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 2306821 Bp335 Blood pressure QTL 335 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 106571501 135012528 Rat 1558655 Swd4 Spike wave discharge measurement QTL 4 3.68 0.0002 brain electrophysiology trait (VT:0010557) brain spike-and-wave discharge severity grade (CMO:0001988) 7 86983365 131983365 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 1331768 Kidm10 Kidney mass QTL 10 4.62096 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 7 80221299 125221299 Rat 61357 Bp38 Blood pressure QTL 38 1.6 0.052 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 41333674 119109060 Rat 2313102 Bmd79 Bone mineral density QTL 79 2.3 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 7 94811085 116738842 Rat 731174 Uae23 Urinary albumin excretion QTL 23 2.4 0.0042 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 7 104603555 135012528 Rat 2316947 Rf58 Renal function QTL 58 7.8 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 7 68938720 113886318 Rat 1331746 Kidm9 Kidney mass QTL 9 3.934 kidney mass (VT:0002707) right kidney wet weight (CMO:0000082) 7 80221299 112308525 Rat 7411654 Foco25 Food consumption QTL 25 9.3 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 7 75918751 120918751 Rat 2316955 Stl24 Serum triglyceride level QTL 24 7.1 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 7 68938720 113886318 Rat 2299163 Iddm34 Insulin dependent diabetes mellitus QTL 34 2.71 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 7 91281130 135012528 Rat 2316952 Pur22 Proteinuria QTL 22 5.2 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 7 68938720 113886318 Rat 631540 Bw9 Body weight QTL 9 4.5 body mass (VT:0001259) body weight (CMO:0000012) 7 69736226 117455174 Rat 1358891 Bp265 Blood pressure QTL 265 2.21 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 7 83591953 134666232 Rat
RH131182
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 108,346,114 - 108,346,265 (+) MAPPER mRatBN7.2 Rnor_6.0 7 117,688,465 - 117,688,615 NCBI Rnor6.0 Rnor_5.0 7 117,676,548 - 117,676,698 UniSTS Rnor5.0 RGSC_v3.4 7 114,674,617 - 114,674,767 UniSTS RGSC3.4 Celera 7 104,696,277 - 104,696,427 UniSTS RH 3.4 Map 7 793.2 UniSTS Cytogenetic Map 7 q34 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000019754 ⟹ ENSRNOP00000019754
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 108,346,047 - 108,360,750 (-) Ensembl Rnor_6.0 Ensembl 7 117,688,397 - 117,703,094 (-) Ensembl
RefSeq Acc Id:
NM_001130572 ⟹ NP_001124044
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 110,226,696 - 110,241,397 (-) NCBI mRatBN7.2 7 108,346,047 - 108,360,750 (-) NCBI Rnor_6.0 7 117,688,397 - 117,703,094 (-) NCBI Rnor_5.0 7 117,676,480 - 117,691,180 (-) NCBI RGSC_v3.4 7 114,674,549 - 114,689,284 (-) RGD Celera 7 104,696,209 - 104,710,912 (-) RGD
Sequence:
GGCTCAGAGAAGCGCGGGAAGTCCAGATTTTCGCGGCGGCGGCGGCGGCGGCGGTGGCTGTGTGAATATGACGCTGGAACAGGAGCTTCGCCAGCTGAGCAAGGCGAAGGCCAGGGCCCAGAGGAATG
hide sequence
RefSeq Acc Id:
XM_008765587 ⟹ XP_008763809
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 110,226,697 - 110,241,459 (-) NCBI mRatBN7.2 7 108,346,048 - 108,360,792 (-) NCBI Rnor_6.0 7 117,688,398 - 117,703,139 (-) NCBI
Sequence:
TGGGTGGGCCCTGCGTGTTAGGGGTGGAACGAGGTAATGGGCGTGGGCTCAGAGAAGCGCGGGA
hide sequence
RefSeq Acc Id:
XM_008765588 ⟹ XP_008763810
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 110,228,746 - 110,241,459 (-) NCBI mRatBN7.2 7 108,348,040 - 108,360,792 (-) NCBI Rnor_6.0 7 117,690,513 - 117,703,139 (-) NCBI
Sequence:
TGGGTGGGCCCTGCGTGTTAGGGGTGGAACGAGGTAATGGGCGTGGGCTCAGAGAAGCGCGGGA
hide sequence
RefSeq Acc Id:
XM_063264054 ⟹ XP_063120124
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 110,228,746 - 110,241,459 (-) NCBI
RefSeq Acc Id:
XM_063264055 ⟹ XP_063120125
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 110,229,557 - 110,241,459 (-) NCBI
RefSeq Acc Id:
NP_001124044 ⟸ NM_001130572
- UniProtKB:
D4A615 (UniProtKB/Swiss-Prot)
- Sequence:
MTLEQELRQLSKAKARAQRNGQLCEEAVCCHQLGELLASHGRFQEALEEHQQELHLLESVQDTLGCAVAHRKIGERLAEMENYSAALKHQHLYLDLAGSLSNHTELQRAWATIGRTHLDVYDHCQSRD
hide sequence
RefSeq Acc Id:
XP_008763809 ⟸ XM_008765587
- Peptide Label:
isoform X1
- Sequence:
MTLEQELRQLSKAKARAQRNGQLCEEAVCCHQLGELLASHGRFQEALEEHQQELHLLESVQDTLGCAVAHRKIGERLAEMENYSAALKHQHLYLDLAGSLSNHTELQRAWATIGRTHLDVYDHCQSRD
hide sequence
RefSeq Acc Id:
XP_008763810 ⟸ XM_008765588
- Peptide Label:
isoform X2
- Sequence:
MTLEQELRQLSKAKARAQRNGQLCEEAVCCHQLGELLASHGRFQEALEEHQQELHLLESVQDTLGCAVAHRKIGERLAEMENYSAALKHQHLYLDLAGSLSNHTELQRAWATIGRTHLDVYDHCQSRD
hide sequence
Ensembl Acc Id:
ENSRNOP00000019754 ⟸ ENSRNOT00000019754
RefSeq Acc Id:
XP_063120124 ⟸ XM_063264054
- Peptide Label:
isoform X3
RefSeq Acc Id:
XP_063120125 ⟸ XM_063264055
- Peptide Label:
isoform X4
RGD ID: 13695431 Promoter ID: EPDNEW_R5955 Type: single initiation site Name: Tonsl_1 Description: tonsoku-like, DNA repair protein SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 7 117,703,066 - 117,703,126 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2011-08-02
Tonsl
tonsoku-like, DNA repair protein
Nfkbil2
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Nfkbil2
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2
Nfkbil2_predicted
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Nfkbil2_predicted
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 (predicted)
Symbol and Name status set to approved
70820 APPROVED
