Symbol:
Il12a
Name:
interleukin 12a
RGD ID:
732140
MGI Page
MGI
Description:
Enables interleukin-12 beta subunit binding activity. Contributes to cytokine activity. Acts upstream of or within several processes, including T-helper 1 cell activation; defense response to protozoan; and positive regulation of T cell activation. Located in cell surface; cytoplasm; and extracellular space. Part of interleukin-12 complex. Is expressed in brain; lung; small intestine; testis; and thymus. Human ortholog(s) of this gene implicated in hepatitis C; hepatocellular carcinoma; and primary biliary cholangitis. Orthologous to human IL12A (interleukin 12A).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
CLMF p35; cytotoxic lymphocyte maturation factor 35 kDa subunit; IL-12; IL-12 p35 subunit; IL-12 subunit p35; Il-12a; IL-12p35; interleukin 12a p35 subunit; interleukin-12 p35 subunit; interleukin-12 subunit alpha; Ll12a; MGC151228; MGC151232; p3; p35
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
IL12A (interleukin 12A) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Il12a (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Il12a (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
IL12A (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
IL12A (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Il12a (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
IL12A (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
IL12A (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Il12a (interleukin 12A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Il12a (interleukin 12A)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PhylomeDB|SonicParanoid)
Homo sapiens (human):
IL12A (interleukin 12A)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
zmp:0000001127
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|PhylomeDB)
Danio rerio (zebrafish):
il12a (interleukin 12a)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|PhylomeDB|ZFIN)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 3 68,597,977 - 68,605,881 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 3 68,597,977 - 68,605,880 (+) Ensembl GRCm39 Ensembl GRCm38 3 68,690,644 - 68,698,550 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 3 68,690,644 - 68,698,547 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 3 68,494,566 - 68,502,469 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 3 68,778,573 - 68,786,454 (+) NCBI MGSCv36 mm8 Celera 3 68,820,603 - 68,828,506 (+) NCBI Celera Cytogenetic Map 3 E1 NCBI cM Map 3 31.92 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Il12a Mouse (S)-nicotine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Nicotine results in increased secretion of [IL12A protein co-treated with IL12B protein]] more ... CTD PMID:21237301 Il12a Mouse 1,2-dichloroethane decreases expression EXP 6480464 ethylene dichloride results in decreased expression of IL12A mRNA CTD PMID:28960355 Il12a Mouse 1-chloro-2,4-dinitrobenzene increases expression ISO Il12a (Rattus norvegicus) 6480464 Dinitrochlorobenzene results in increased expression of IL12A mRNA CTD PMID:25449201 Il12a Mouse 1-chloro-2,4-dinitrobenzene decreases expression EXP 6480464 Dinitrochlorobenzene results in decreased expression of IL12A mRNA CTD PMID:28219650 Il12a Mouse 17beta-estradiol multiple interactions EXP 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of IL12A mRNA CTD PMID:19693291 Il12a Mouse 17beta-estradiol increases expression ISO IL12A (Homo sapiens) 6480464 Estradiol results in increased expression of IL12A mRNA CTD PMID:36828454 Il12a Mouse 17beta-estradiol multiple interactions ISO IL12A (Homo sapiens) 6480464 [Progesterone co-treated with Estradiol] inhibits the reaction [Vaccines more ... CTD PMID:20130130 Il12a Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of IL12A mRNA CTD PMID:19693291 Il12a Mouse 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO Il12a (Rattus norvegicus) 6480464 2 more ... CTD PMID:27291303 Il12a Mouse 2,2',4,4'-Tetrabromodiphenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:33078840 Il12a Mouse 2,2',5,5'-tetrachlorobiphenyl increases expression ISO IL12A (Homo sapiens) 6480464 2 more ... CTD PMID:21703328 Il12a Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 Tetrachlorodibenzodioxin inhibits the reaction [[CpG ODN 1826 binds to and results in increased activity of TLR9 protein] results in increased secretion of [IL12A protein binds to IL12B protein]] more ... CTD PMID:21097750 Il12a Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO IL12A (Homo sapiens) 6480464 AHR protein affects the reaction [Tetrachlorodibenzodioxin inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA]] more ... CTD PMID:27783115 Il12a Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of IL12A mRNA CTD PMID:12167310 Il12a Mouse 2,3-bis(4-hydroxyphenyl)propionitrile multiple interactions EXP 6480464 2 and 3-bis(4-hydroxyphenyl)-propionitrile inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A protein] CTD PMID:30017638 Il12a Mouse 2,4,6-trinitrobenzenesulfonic acid increases expression EXP 6480464 Trinitrobenzenesulfonic Acid results in increased expression of IL12A mRNA CTD PMID:15973123 Il12a Mouse 2-tert-butylhydroquinone multiple interactions ISO IL12A (Homo sapiens) 6480464 2-tert-butylhydroquinone inhibits the reaction [lipopolysaccharide more ... CTD PMID:25680285 Il12a Mouse 3',5'-cyclic AMP multiple interactions ISO IL12A (Homo sapiens) 6480464 Cyclic AMP promotes the reaction [[Histamine results in increased activity of HRH2 protein] which results in decreased expression of IL12A protein] CTD PMID:15843518 Il12a Mouse 3,3',4,4',5-pentachlorobiphenyl multiple interactions EXP 6480464 3 more ... CTD PMID:29216392 Il12a Mouse 3,3',5,5'-tetrabromobisphenol A decreases expression EXP 6480464 tetrabromobisphenol A results in decreased expression of IL12A mRNA CTD PMID:33078840 Il12a Mouse 3,5-diethoxycarbonyl-1,4-dihydrocollidine multiple interactions EXP 6480464 [NFE2L2 gene mutant form results in increased susceptibility to 3 more ... CTD PMID:30825315 Il12a Mouse 3-iodobenzyl-5'-N-methylcarboxamidoadenosine multiple interactions ISO IL12A (Homo sapiens) 6480464 N(6)-(3-iodobenzyl)-5'-N-methylcarboxamidoadenosine results in decreased expression of [IL12A protein binds to IL12B protein] more ... CTD PMID:16116186 Il12a Mouse 3-methylcholanthrene increases expression ISO IL12A (Homo sapiens) 6480464 Methylcholanthrene results in increased expression of IL12A mRNA CTD PMID:14993811 Il12a Mouse 3-phenylprop-2-enal affects expression EXP 6480464 cinnamaldehyde affects the expression of IL12A mRNA CTD PMID:28219650 Il12a Mouse 3-phenylprop-2-enal multiple interactions EXP 6480464 NFE2L2 protein inhibits the reaction [cinnamaldehyde results in increased expression of IL12A mRNA] CTD PMID:28219650 Il12a Mouse 4,4'-sulfonyldiphenol decreases expression EXP 6480464 bisphenol S results in decreased expression of IL12A mRNA CTD PMID:33078840 Il12a Mouse 4-methylhistamine multiple interactions ISO IL12A (Homo sapiens) 6480464 4-methylhistamine inhibits the reaction [IL18 protein results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:11752121 and PMID:12364868 Il12a Mouse 4-nitroquinoline N-oxide increases expression EXP 6480464 4-Nitroquinoline-1-oxide results in increased expression of IL12A mRNA CTD PMID:22561872 Il12a Mouse 7,12-dimethyltetraphene multiple interactions EXP 6480464 IL12A results in decreased susceptibility to [9 more ... CTD PMID:22359662 Il12a Mouse 9-cis-retinoic acid multiple interactions ISO IL12A (Homo sapiens) 6480464 Alitretinoin inhibits the reaction [Lipopolysaccharides results in increased secretion of [IL12A protein binds to IL12B protein]] and Alitretinoin results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:17118196 and PMID:17475839 Il12a Mouse acetylsalicylic acid multiple interactions ISO IL12A (Homo sapiens) 6480464 Aspirin inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:15379866 Il12a Mouse actinomycin D multiple interactions ISO IL12A (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of IL12A mRNA CTD PMID:38460933 Il12a Mouse aflatoxin B1 affects expression ISO IL12A (Homo sapiens) 6480464 Aflatoxin B1 affects the expression of IL12A protein CTD PMID:20106945 Il12a Mouse aflatoxin B1 increases expression ISO IL12A (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of IL12A mRNA CTD PMID:22100608 Il12a Mouse all-trans-retinoic acid multiple interactions ISO IL12A (Homo sapiens) 6480464 RARA protein affects the reaction [Tretinoin results in decreased secretion of [IL12A protein binds to IL12B protein]] more ... CTD PMID:16872382 and PMID:17118196 Il12a Mouse all-trans-retinoic acid decreases expression ISO IL12A (Homo sapiens) 6480464 Tretinoin results in decreased expression of IL12A mRNA CTD PMID:15189689 and PMID:16872382 Il12a Mouse Alpinetin multiple interactions ISO IL12A (Homo sapiens) 6480464 alpinetin inhibits the reaction [IL1B protein results in increased secretion of IL12A protein] and TLR4 protein inhibits the reaction [alpinetin inhibits the reaction [IL1B protein results in increased secretion of IL12A protein]] CTD PMID:39322069 Il12a Mouse ammonium chloride affects expression ISO Il12a (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of IL12A mRNA CTD PMID:16483693 Il12a Mouse anthranilic acid multiple interactions ISO IL12A (Homo sapiens) 6480464 anthranilic acid analog inhibits the reaction [[IL12A protein binds to IL12B protein] which results in increased secretion of IFNG protein] CTD PMID:15799959 Il12a Mouse antimony(0) affects response to substance EXP 6480464 IL12A protein affects the susceptibility to Antimony CTD PMID:11023473 Il12a Mouse apilimod multiple interactions ISO IL12A (Homo sapiens) 6480464 apilimod inhibits the reaction [[IFNG protein co-treated with Lipopolysaccharides] results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:17053051 Il12a Mouse aristolochic acid A increases expression ISO IL12A (Homo sapiens) 6480464 aristolochic acid I results in increased expression of IL12A mRNA CTD PMID:33212167 Il12a Mouse arsane decreases expression ISO IL12A (Homo sapiens) 6480464 Arsenic results in decreased expression of IL12A mRNA CTD PMID:27838757 Il12a Mouse arsenic atom decreases expression ISO IL12A (Homo sapiens) 6480464 Arsenic results in decreased expression of IL12A mRNA CTD PMID:27838757 Il12a Mouse arsenite(3-) multiple interactions ISO IL12A (Homo sapiens) 6480464 arsenite inhibits the reaction [[IFNG protein co-treated with lipopolysaccharide more ... CTD PMID:25680285 Il12a Mouse arsenite(3-) multiple interactions EXP 6480464 arsenite inhibits the reaction [lipopolysaccharide more ... CTD PMID:25680285 Il12a Mouse atorvastatin calcium decreases expression ISO IL12A (Homo sapiens) 6480464 Atorvastatin results in decreased expression of IL12A mRNA CTD PMID:12492458 Il12a Mouse azathioprine multiple interactions ISO IL12A (Homo sapiens) 6480464 Azathioprine results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:19584951 Il12a Mouse benzene affects response to substance ISO IL12A (Homo sapiens) 6480464 IL12A gene SNP affects the susceptibility to Benzene CTD PMID:16230423 Il12a Mouse benzo[a]pyrene multiple interactions EXP 6480464 Resveratrol inhibits the reaction [Benzo(a)pyrene results in increased expression of IL12A mRNA] CTD PMID:30165701 Il12a Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of IL12A mRNA CTD PMID:34437932 Il12a Mouse benzo[a]pyrene increases expression ISO IL12A (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of IL12A mRNA CTD PMID:32234424 Il12a Mouse benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of IL12A mRNA CTD PMID:30165701 and PMID:33245929 Il12a Mouse benzo[a]pyrene diol epoxide I increases expression ISO IL12A (Homo sapiens) 6480464 7 more ... CTD PMID:20382639 Il12a Mouse Benzo[ghi]perylene increases expression ISO IL12A (Homo sapiens) 6480464 1 and 12-benzoperylene results in increased expression of IL12A mRNA CTD PMID:35182551 Il12a Mouse Benzo[ghi]perylene multiple interactions ISO IL12A (Homo sapiens) 6480464 [2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide co-treated with 1 and 12-benzoperylene] results in increased expression of IL12A mRNA CTD PMID:35182551 Il12a Mouse beta-D-glucan multiple interactions ISO IL12A (Homo sapiens) 6480464 [beta-Glucans co-treated with resiquimod co-treated with IFNG protein] results in increased expression of IL12A mRNA more ... CTD PMID:18490488 Il12a Mouse beta-lapachone increases expression ISO IL12A (Homo sapiens) 6480464 beta-lapachone results in increased expression of IL12A mRNA CTD PMID:38218311 Il12a Mouse beta-naphthoflavone multiple interactions ISO Il12a (Rattus norvegicus) 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of IL12A mRNA CTD PMID:18164116 Il12a Mouse betulin multiple interactions EXP 6480464 betulin results in increased secretion of [IL12A protein binds to IL12B protein] CTD PMID:25756279 Il12a Mouse betulin increases expression EXP 6480464 betulin results in increased expression of IL12A mRNA CTD PMID:25756279 Il12a Mouse bisphenol A multiple interactions ISO Il12a (Rattus norvegicus) 6480464 [bisphenol A co-treated with Testosterone] results in decreased expression of IL12A mRNA CTD PMID:26496021 Il12a Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of IL12A mRNA CTD PMID:33706241 Il12a Mouse bisphenol A multiple interactions EXP 6480464 [bisphenol A affects the susceptibility to Ovalbumin] results in decreased expression of and results in decreased secretion of [IL12A protein binds to IL12B protein] more ... CTD PMID:29737898 more ... Il12a Mouse bisphenol A affects expression ISO IL12A (Homo sapiens) 6480464 bisphenol A affects the expression of IL12A mRNA and bisphenol A affects the expression of IL12A protein CTD PMID:31715268 Il12a Mouse bisphenol F multiple interactions EXP 6480464 bisphenol F results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:35278557 Il12a Mouse Butylbenzyl phthalate increases expression EXP 6480464 butylbenzyl phthalate results in increased expression of IL12A mRNA CTD PMID:36746855 Il12a Mouse cadmium atom multiple interactions ISO IL12A (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of IL12A mRNA CTD PMID:35301059 Il12a Mouse cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of IL12A mRNA alternative form CTD PMID:24583143 Il12a Mouse cadmium dichloride multiple interactions ISO IL12A (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of IL12A mRNA CTD PMID:35301059 Il12a Mouse cadmium dichloride decreases expression ISO IL12A (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of IL12A mRNA CTD PMID:38382870 Il12a Mouse caffeine decreases expression ISO IL12A (Homo sapiens) 6480464 Caffeine results in decreased expression of IL12A mRNA CTD PMID:28089782 Il12a Mouse cannabidiol multiple interactions EXP 6480464 Cannabidiol inhibits the reaction [MOG protein modified form results in increased expression of IL12A mRNA] CTD PMID:27256343 Il12a Mouse carbamate ester increases expression ISO IL12A (Homo sapiens) 6480464 Carbamates analog results in increased expression of IL12A protein CTD PMID:19111005 and PMID:19376255 Il12a Mouse carbamazepine decreases expression EXP 6480464 Carbamazepine results in decreased expression of IL12A mRNA CTD PMID:22790970 Il12a Mouse carvedilol multiple interactions ISO IL12A (Homo sapiens) 6480464 carvedilol promotes the reaction [Hemagglutinins results in increased expression of [IL12A protein binds to IL12B protein]] and carvedilol promotes the reaction [Lipopolysaccharides results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:15229385 Il12a Mouse casticin decreases expression ISO IL12A (Homo sapiens) 6480464 casticin results in decreased expression of IL12A mRNA CTD PMID:27862857 Il12a Mouse CGS-21680 multiple interactions ISO IL12A (Homo sapiens) 6480464 [2-(4-(2-carboxyethyl)phenethylamino)-5'-N-ethylcarboxamidoadenosine co-treated with TNF protein] results in decreased expression of IL12A mRNA CTD PMID:22923002 Il12a Mouse chlorophyllin multiple interactions EXP 6480464 chlorophyllin inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:16275627 Il12a Mouse chloroprene decreases expression EXP 6480464 Chloroprene results in decreased expression of IL12A mRNA CTD PMID:23125180 Il12a Mouse cisplatin increases expression ISO IL12A (Homo sapiens) 6480464 Cisplatin results in increased expression of IL12A mRNA CTD PMID:19561079 and PMID:27392435 Il12a Mouse clofibrate increases expression EXP 6480464 Clofibrate results in increased expression of IL12A mRNA CTD PMID:17585979 Il12a Mouse colforsin daropate hydrochloride decreases expression EXP 6480464 Colforsin results in decreased expression of IL12A protein CTD PMID:10996031 Il12a Mouse copper atom increases expression ISO Il12a (Rattus norvegicus) 6480464 Copper results in increased expression of IL12A mRNA CTD PMID:30556269 Il12a Mouse copper(0) increases expression ISO Il12a (Rattus norvegicus) 6480464 Copper results in increased expression of IL12A mRNA CTD PMID:30556269 Il12a Mouse crocidolite asbestos decreases expression ISO IL12A (Homo sapiens) 6480464 Asbestos and Crocidolite results in decreased expression of IL12A mRNA CTD PMID:24160326 Il12a Mouse curcumin multiple interactions ISO IL12A (Homo sapiens) 6480464 Curcumin inhibits the reaction [Oxygen deficiency results in increased expression of IL12A mRNA] CTD PMID:23452621 Il12a Mouse cyclophosphamide multiple interactions EXP 6480464 [Doxorubicin co-treated with Cyclophosphamide] results in decreased expression of [IL12A protein binds to IL12B protein] and ganoderic acid C2 inhibits the reaction [Cyclophosphamide results in decreased expression of IL12A protein] CTD PMID:29228376 and PMID:37853057 Il12a Mouse cyclophosphamide decreases expression EXP 6480464 Cyclophosphamide results in decreased expression of IL12A protein CTD PMID:37853057 Il12a Mouse cyclosporin A multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [Zymosan results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:17312158 Il12a Mouse cyclosporin A increases expression ISO IL12A (Homo sapiens) 6480464 Cyclosporine results in increased expression of IL12A mRNA CTD PMID:20106945 and PMID:25562108 Il12a Mouse daidzein multiple interactions EXP 6480464 daidzein inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:21945492 Il12a Mouse deoxynivalenol increases expression EXP 6480464 deoxynivalenol results in increased expression of IL12A mRNA CTD PMID:9707511 Il12a Mouse deoxynivalenol increases expression ISO IL12A (Homo sapiens) 6480464 deoxynivalenol results in increased expression of IL12A mRNA CTD PMID:27757495 Il12a Mouse dexamethasone multiple interactions EXP 6480464 Dexamethasone inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:22185406 Il12a Mouse dexamethasone increases expression EXP 6480464 Dexamethasone results in increased expression of IL12A mRNA CTD PMID:22185406 Il12a Mouse dextran sulfate affects response to substance EXP 6480464 IL12A protein affects the susceptibility to Dextran Sulfate CTD PMID:12940437 Il12a Mouse diallyl trisulfide increases expression ISO IL12A (Homo sapiens) 6480464 diallyl trisulfide results in increased expression of IL12A mRNA CTD PMID:34995734 Il12a Mouse diazinon increases methylation ISO IL12A (Homo sapiens) 6480464 Diazinon results in increased methylation of IL12A gene CTD PMID:22964155 Il12a Mouse dichlorine increases expression EXP 6480464 Chlorine results in increased expression of IL12A protein CTD PMID:23146759 Il12a Mouse diltiazem multiple interactions ISO IL12A (Homo sapiens) 6480464 Diltiazem inhibits the reaction [[NFKB1 protein binds to RELA protein] which binds to IL12A promoter] more ... CTD PMID:15652234 Il12a Mouse diltiazem decreases expression ISO IL12A (Homo sapiens) 6480464 Diltiazem results in decreased expression of IL12A mRNA CTD PMID:15652234 Il12a Mouse Dimaprit multiple interactions ISO IL12A (Homo sapiens) 6480464 Dimaprit inhibits the reaction [IL18 protein results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:11752121 and PMID:12364868 Il12a Mouse dioxygen multiple interactions ISO IL12A (Homo sapiens) 6480464 3 more ... CTD PMID:23452621 Il12a Mouse dioxygen increases expression ISO IL12A (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of IL12A mRNA CTD PMID:17175027 and PMID:23452621 Il12a Mouse doxorubicin multiple interactions EXP 6480464 [Doxorubicin co-treated with Cyclophosphamide] results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:29228376 Il12a Mouse esketamine decreases expression ISO IL12A (Homo sapiens) 6480464 Esketamine results in decreased expression of IL12A mRNA CTD PMID:38219984 Il12a Mouse estriol increases expression EXP 6480464 Estriol results in increased expression of IL12A mRNA CTD PMID:21317386 Il12a Mouse ethanol multiple interactions EXP 6480464 Ethanol inhibits the reaction [Lipopolysaccharides results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:10798593 Il12a Mouse ethyl methanesulfonate decreases expression ISO IL12A (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of IL12A mRNA CTD PMID:23649840 Il12a Mouse eugenol multiple interactions EXP 6480464 Eugenol inhibits the reaction [Nicotine results in increased secretion of [IL12A protein co-treated with IL12B protein]] CTD PMID:21237301 Il12a Mouse famotidine multiple interactions ISO IL12A (Homo sapiens) 6480464 Famotidine inhibits the reaction [Histamine inhibits the reaction [IL18 protein results in increased expression of [IL12A protein binds to IL12B protein]]] CTD PMID:11752121 and PMID:12364868 Il12a Mouse fumigaclavine C decreases expression EXP 6480464 fumigaclavine C results in decreased expression of IL12A mRNA CTD PMID:16023606 Il12a Mouse fumonisin B1 increases expression ISO IL12A (Homo sapiens) 6480464 fumonisin B1 results in increased expression of IL12A mRNA CTD PMID:27757495 Il12a Mouse Ganoderic acid C2 multiple interactions EXP 6480464 ganoderic acid C2 inhibits the reaction [Cyclophosphamide results in decreased expression of IL12A protein] CTD PMID:37853057 Il12a Mouse genistein multiple interactions ISO IL12A (Homo sapiens) 6480464 Genistein inhibits the reaction [Oxygen deficiency results in increased expression of IL12A mRNA] CTD PMID:23452621 Il12a Mouse gentamycin decreases expression ISO Il12a (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of IL12A mRNA and Gentamicins results in decreased expression of IL12A protein CTD PMID:22061828 and PMID:25051504 Il12a Mouse glucuronoxylomannan multiple interactions ISO IL12A (Homo sapiens) 6480464 glucuronoxylomannan results in decreased secretion of [IL12A protein binds to IL12B protein] CTD PMID:12864811 Il12a Mouse glycyrrhizinic acid multiple interactions EXP 6480464 [Glycyrrhizic Acid co-treated with Lipopolysaccharides] results in increased expression of [IL12A protein binds to IL12B protein] and [Glycyrrhizic Acid co-treated with Lipopolysaccharides] results in increased expression of IL12A mRNA CTD PMID:11412311 Il12a Mouse helenalin multiple interactions ISO IL12A (Homo sapiens) 6480464 helenalin inhibits the reaction [Drugs more ... CTD PMID:15894585 Il12a Mouse histamine multiple interactions ISO IL12A (Homo sapiens) 6480464 [Histamine results in increased activity of HRH2 protein] which results in decreased expression of IL12A protein more ... CTD PMID:11752121 more ... Il12a Mouse histamine increases expression ISO IL12A (Homo sapiens) 6480464 Histamine results in increased expression of IL12A protein CTD PMID:15843518 Il12a Mouse histamine decreases expression ISO IL12A (Homo sapiens) 6480464 Histamine results in decreased expression of IL12A mRNA and Histamine results in decreased expression of IL12A protein CTD PMID:9819373 Il12a Mouse hydrogen peroxide multiple interactions EXP 6480464 Hydrogen Peroxide results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:16249388 Il12a Mouse Ibudilast decreases expression EXP 6480464 ibudilast results in decreased expression of IL12A mRNA CTD PMID:14664469 Il12a Mouse Ibudilast multiple interactions EXP 6480464 ibudilast results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:14664469 Il12a Mouse imiquimod multiple interactions EXP 6480464 [imiquimod binds to and results in increased activity of TLR7 protein] results in increased secretion of [IL12A protein binds to IL12B protein] and Tetrachlorodibenzodioxin inhibits the reaction [[imiquimod binds to and results in increased activity of TLR7 protein] results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:21097750 Il12a Mouse imiquimod increases secretion EXP 6480464 Imiquimod results in increased secretion of IL12A protein CTD PMID:31093508 Il12a Mouse indole-3-methanol multiple interactions ISO IL12A (Homo sapiens) 6480464 indole-3-carbinol inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] and indole-3-carbinol inhibits the reaction [Poly I-C results in increased expression of IL12A mRNA] CTD PMID:27783115 Il12a Mouse indometacin multiple interactions EXP 6480464 Indomethacin results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:11703811 Il12a Mouse iron atom multiple interactions ISO IL12A (Homo sapiens) 6480464 Iron affects the reaction [[IL12A protein binds to IL12B protein] which results in increased secretion of IFNG protein] CTD PMID:15799959 Il12a Mouse iron dichloride increases expression ISO IL12A (Homo sapiens) 6480464 ferrous chloride results in increased expression of IL12A mRNA CTD PMID:35984750 Il12a Mouse iron(0) multiple interactions ISO IL12A (Homo sapiens) 6480464 Iron affects the reaction [[IL12A protein binds to IL12B protein] which results in increased secretion of IFNG protein] CTD PMID:15799959 Il12a Mouse isocyanates increases expression ISO IL12A (Homo sapiens) 6480464 Isocyanates analog results in increased expression of IL12A protein CTD PMID:19111005 Il12a Mouse isoniazide increases secretion ISO IL12A (Homo sapiens) 6480464 Isoniazid results in increased secretion of IL12A protein CTD PMID:28444390 Il12a Mouse isoprenaline decreases expression ISO Il12a (Rattus norvegicus) 6480464 Isoproterenol results in decreased expression of IL12A protein CTD PMID:24286936 Il12a Mouse kainic acid affects response to substance EXP 6480464 IL12A protein affects the susceptibility to Kainic Acid CTD PMID:15474355 Il12a Mouse ketamine increases expression ISO Il12a (Rattus norvegicus) 6480464 Ketamine results in increased expression of IL12A mRNA CTD PMID:20080153 Il12a Mouse lead diacetate decreases expression EXP 6480464 lead acetate results in decreased expression of IL12A mRNA CTD PMID:21829687 Il12a Mouse lead(0) multiple interactions EXP 6480464 Lead results in increased expression of and results in increased secretion of [IL12A protein binds to IL12B protein] CTD PMID:28973681 Il12a Mouse leukotriene D4 multiple interactions ISO IL12A (Homo sapiens) 6480464 BAY u9773 inhibits the reaction [Leukotriene D4 results in increased secretion of [IL12A protein binds to IL12B protein]] more ... CTD PMID:19118273 Il12a Mouse lipid As multiple interactions ISO IL12A (Homo sapiens) 6480464 [Acetylmuramyl-Alanyl-Isoglutamine co-treated with Lipid A] results in increased expression of [IL12A protein binds to IL12B protein] more ... CTD PMID:16299289 Il12a Mouse lipid As increases expression ISO IL12A (Homo sapiens) 6480464 Lipid A results in increased expression of IL12A mRNA CTD PMID:16299289 Il12a Mouse lipopolysaccharide increases secretion EXP 6480464 Lipopolysaccharides results in increased secretion of IL12A protein CTD PMID:32800949 Il12a Mouse lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of IL12A mRNA and Lipopolysaccharides results in increased expression of IL12A protein CTD PMID:10415056 more ... Il12a Mouse lipopolysaccharide increases expression ISO IL12A (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of IL12A mRNA CTD PMID:12470611 more ... Il12a Mouse lipopolysaccharide multiple interactions ISO IL12A (Homo sapiens) 6480464 2'-hydroxyflavanone inhibits the reaction [Lipopolysaccharides results in increased secretion of IL12A protein] more ... CTD PMID:10651989 more ... Il12a Mouse lipopolysaccharide multiple interactions EXP 6480464 2 more ... CTD PMID:10415056 more ... Il12a Mouse lipopolysaccharide increases secretion ISO IL12A (Homo sapiens) 6480464 Lipopolysaccharides results in increased secretion of IL12A protein CTD PMID:32800949 Il12a Mouse lupane multiple interactions ISO IL12A (Homo sapiens) 6480464 lupane results in increased secretion of [IL12A protein binds to IL12B protein] CTD PMID:16388738 Il12a Mouse manganese atom increases expression ISO IL12A (Homo sapiens) 6480464 Manganese results in increased expression of IL12A mRNA CTD PMID:17175027 Il12a Mouse manganese(0) increases expression ISO IL12A (Homo sapiens) 6480464 Manganese results in increased expression of IL12A mRNA CTD PMID:17175027 Il12a Mouse manganese(II) chloride increases expression ISO IL12A (Homo sapiens) 6480464 manganese chloride results in increased expression of IL12A mRNA CTD PMID:17175027 Il12a Mouse manganese(II) chloride multiple interactions ISO IL12A (Homo sapiens) 6480464 manganese chloride promotes the reaction [SNCA protein results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:28539244 Il12a Mouse manganese(II) chloride multiple interactions EXP 6480464 manganese chloride results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:28539244 Il12a Mouse mangiferin decreases expression EXP 6480464 mangiferin results in decreased expression of IL12A mRNA CTD PMID:15135318 Il12a Mouse mechlorethamine increases expression ISO Il12a (Rattus norvegicus) 6480464 Mechlorethamine results in increased expression of IL12A mRNA CTD PMID:26273949 Il12a Mouse melphalan increases expression ISO IL12A (Homo sapiens) 6480464 Melphalan results in increased expression of IL12A mRNA CTD PMID:22363485 Il12a Mouse mercury dichloride multiple interactions EXP 6480464 Mercuric Chloride results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:21984480 Il12a Mouse metam multiple interactions EXP 6480464 methyldithiocarbamate inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:15933225 Il12a Mouse methotrexate decreases expression ISO IL12A (Homo sapiens) 6480464 Methotrexate results in decreased expression of IL12A mRNA CTD PMID:22133036 Il12a Mouse methyl 3,4,5-trihydroxybenzoate multiple interactions EXP 6480464 methyl gallate results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:32112863 Il12a Mouse methyl isothiocyanate multiple interactions EXP 6480464 methyl isothiocyanate inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:15933225 Il12a Mouse methyl methanesulfonate decreases expression ISO IL12A (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of IL12A mRNA CTD PMID:23649840 Il12a Mouse MK-2206 multiple interactions ISO IL12A (Homo sapiens) 6480464 MK 2206 inhibits the reaction [RARRES2 protein results in increased secretion of [IL12A protein binds to IL12B protein]] and MK 2206 results in decreased secretion of [IL12A protein binds to IL12B protein] CTD PMID:34398343 Il12a Mouse montelukast multiple interactions ISO IL12A (Homo sapiens) 6480464 montelukast inhibits the reaction [Leukotriene D4 results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:19118273 Il12a Mouse morphine multiple interactions EXP 6480464 Morphine affects the expression of [IL12A protein binds to IL12B protein] CTD PMID:16299287 Il12a Mouse muramyl dipeptide multiple interactions ISO IL12A (Homo sapiens) 6480464 [Acetylmuramyl-Alanyl-Isoglutamine co-treated with Lipid A] results in increased expression of [IL12A protein binds to IL12B protein] more ... CTD PMID:16299289 and PMID:18490488 Il12a Mouse N-acetyl-L-cysteine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Nicotine results in increased secretion of [IL12A protein co-treated with IL12B protein]] CTD PMID:21237301 Il12a Mouse N-nitrosodiethylamine multiple interactions ISO Il12a (Rattus norvegicus) 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of IL12A mRNA CTD PMID:18164116 Il12a Mouse N1'-[2-[[5-[(dimethylamino)methyl]-2-furanyl]methylthio]ethyl]-N1-methyl-2-nitroethene-1,1-diamine multiple interactions ISO IL12A (Homo sapiens) 6480464 Ranitidine inhibits the reaction [Histamine inhibits the reaction [IL18 protein results in increased expression of [IL12A protein binds to IL12B protein]]] and Ranitidine inhibits the reaction [Histamine results in decreased expression of IL12A protein] CTD PMID:11752121 and PMID:9819373 Il12a Mouse neocuproine multiple interactions EXP 6480464 neocuproine inhibits the reaction [lipopolysaccharide and E coli O55-B5 results in increased expression of IL12A protein] CTD PMID:23604539 Il12a Mouse nickel sulfate increases expression ISO IL12A (Homo sapiens) 6480464 nickel sulfate results in increased expression of IL12A mRNA CTD PMID:30421605 Il12a Mouse niclosamide multiple interactions ISO IL12A (Homo sapiens) 6480464 Niclosamide inhibits the reaction [IL6 protein results in increased expression of IL12A mRNA] CTD PMID:26297436 Il12a Mouse nicotine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Nicotine results in increased secretion of [IL12A protein co-treated with IL12B protein]] more ... CTD PMID:21237301 Il12a Mouse nonanoic acid increases expression EXP 6480464 pelargonic acid results in increased expression of IL12A mRNA CTD PMID:18652873 Il12a Mouse Nutlin-3 multiple interactions ISO IL12A (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of IL12A mRNA CTD PMID:38460933 Il12a Mouse o-anisidine increases expression ISO IL12A (Homo sapiens) 6480464 2-anisidine results in increased expression of IL12A mRNA CTD PMID:28089782 Il12a Mouse ochratoxin A decreases expression ISO IL12A (Homo sapiens) 6480464 ochratoxin A results in decreased expression of IL12A mRNA CTD PMID:30763683 Il12a Mouse ozone multiple interactions ISO IL12A (Homo sapiens) 6480464 [Vehicle Emissions co-treated with Ozone] results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:27058360 Il12a Mouse ozone increases expression EXP 6480464 Ozone results in increased expression of IL12A mRNA CTD PMID:27240593 Il12a Mouse paclitaxel multiple interactions EXP 6480464 CD14 protein affects the reaction [Paclitaxel results in increased expression of IL12A mRNA] more ... CTD PMID:11123339 Il12a Mouse paclitaxel increases expression EXP 6480464 Paclitaxel results in increased expression of IL12A mRNA CTD PMID:11123339 Il12a Mouse paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of IL12A mRNA CTD PMID:33887374 Il12a Mouse paracetamol multiple interactions EXP 6480464 [IL33 protein affects the susceptibility to Acetaminophen] which affects the expression of IL12A mRNA CTD PMID:33887374 Il12a Mouse PCB138 affects expression ISO IL12A (Homo sapiens) 6480464 2 more ... CTD PMID:21703328 Il12a Mouse phorbol 12,13-dibutanoate increases expression ISO IL12A (Homo sapiens) 6480464 Phorbol 12 and 13-Dibutyrate results in increased expression of IL12A mRNA CTD PMID:15516327 Il12a Mouse phorbol 13-acetate 12-myristate multiple interactions EXP 6480464 IL12A results in decreased susceptibility to [9 more ... CTD PMID:22359662 Il12a Mouse pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of IL12A protein CTD PMID:20131406 Il12a Mouse poly(I:C) multiple interactions ISO IL12A (Homo sapiens) 6480464 6-formylindolo(3 more ... CTD PMID:27783115 and PMID:35688559 Il12a Mouse poly(I:C) increases expression ISO IL12A (Homo sapiens) 6480464 Poly I-C results in increased expression of IL12A mRNA CTD PMID:27783115 Il12a Mouse polymyxin B2 multiple interactions EXP 6480464 Polymyxin B inhibits the reaction [[Ovalbumin co-treated with Dust] results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:26882889 Il12a Mouse prednisone multiple interactions ISO IL12A (Homo sapiens) 6480464 Prednisone results in increased expression of [IL12A protein binds to IL12B protein] CTD PMID:19584951 Il12a Mouse pristane affects response to substance EXP 6480464 IL12A protein affects the susceptibility to pristane CTD PMID:12911539 Il12a Mouse progesterone multiple interactions EXP 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of IL12A mRNA CTD PMID:19693291 Il12a Mouse progesterone multiple interactions ISO IL12A (Homo sapiens) 6480464 [Progesterone co-treated with Estradiol] inhibits the reaction [Vaccines more ... CTD PMID:20130130 Il12a Mouse prostaglandin E2 multiple interactions ISO IL12A (Homo sapiens) 6480464 Dinoprostone inhibits the reaction [Lipopolysaccharides results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:11369638 Il12a Mouse raloxifene decreases expression ISO IL12A (Homo sapiens) 6480464 Raloxifene Hydrochloride results in decreased expression of IL12A mRNA CTD PMID:19429434 Il12a Mouse ranitidine multiple interactions ISO IL12A (Homo sapiens) 6480464 Ranitidine inhibits the reaction [Histamine inhibits the reaction [IL18 protein results in increased expression of [IL12A protein binds to IL12B protein]]] and Ranitidine inhibits the reaction [Histamine results in decreased expression of IL12A protein] CTD PMID:11752121 and PMID:9819373 Il12a Mouse resiquimod multiple interactions EXP 6480464 [resiquimod co-treated with Lipopolysaccharides] results in increased secretion of [IL12A protein binds to IL12B protein] CTD PMID:15851485 Il12a Mouse resiquimod multiple interactions ISO IL12A (Homo sapiens) 6480464 [Acetylmuramyl-Alanyl-Isoglutamine co-treated with resiquimod co-treated with IFNG protein] results in increased expression of [IL12A protein binds to IL12B protein] more ... CTD PMID:18490488 and PMID:35688559 Il12a Mouse resveratrol multiple interactions EXP 6480464 Resveratrol inhibits the reaction [Benzo(a)pyrene results in increased expression of IL12A mRNA] and Resveratrol inhibits the reaction [Lipopolysaccharides results in increased expression of and results in increased secretion of IL12A protein] CTD PMID:14996416 and PMID:30165701 Il12a Mouse resveratrol multiple interactions ISO IL12A (Homo sapiens) 6480464 resveratrol inhibits the reaction [Oxygen deficiency results in increased expression of IL12A mRNA] and resveratrol promotes the reaction [Lipopolysaccharides results in increased secretion of [IL12B protein co-treated with IL12A protein]] CTD PMID:15135313 and PMID:23452621 Il12a Mouse ribavirin multiple interactions ISO IL12A (Homo sapiens) 6480464 [Ribavirin co-treated with IFNA2 protein] promotes the reaction [Lipopolysaccharides results in increased secretion of [IL12A protein binds to IL12B protein]] and Ribavirin promotes the reaction [Lipopolysaccharides results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:9722937 Il12a Mouse Ro 41-5253 multiple interactions ISO IL12A (Homo sapiens) 6480464 Ro 41-5253 inhibits the reaction [Tretinoin results in decreased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:16872382 Il12a Mouse S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO IL12A (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:35811015 Il12a Mouse SB 203580 multiple interactions ISO IL12A (Homo sapiens) 6480464 SB 203580 inhibits the reaction [[IL12A protein binds to IL12B protein] which results in increased expression of IFNG protein] more ... CTD PMID:10952721 and PMID:15894585 Il12a Mouse SB 203580 multiple interactions EXP 6480464 SB 203580 inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:11006016 Il12a Mouse silicon dioxide multiple interactions EXP 6480464 IL12A gene mutant form promotes the reaction [Silicon Dioxide results in increased expression of and results in increased secretion of IL12B protein] CTD PMID:12193738 Il12a Mouse silicon dioxide increases response to substance EXP 6480464 IL12A gene mutant form results in increased susceptibility to Silicon Dioxide CTD PMID:12193738 Il12a Mouse sirolimus multiple interactions EXP 6480464 Sirolimus inhibits the reaction [IL4 protein results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:12531798 Il12a Mouse stattic multiple interactions ISO IL12A (Homo sapiens) 6480464 stattic inhibits the reaction [IL6 protein results in increased expression of IL12A mRNA] CTD PMID:26297436 Il12a Mouse sulfasalazine multiple interactions EXP 6480464 Sulfasalazine inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased expression of [IL12B protein binds to IL12A protein]] CTD PMID:11529938 Il12a Mouse temozolomide increases expression ISO IL12A (Homo sapiens) 6480464 Temozolomide results in increased expression of IL12A mRNA CTD PMID:31758290 Il12a Mouse testosterone decreases expression EXP 6480464 Testosterone results in decreased expression of IL12A mRNA CTD PMID:19693291 Il12a Mouse testosterone multiple interactions ISO Il12a (Rattus norvegicus) 6480464 [bisphenol A co-treated with Testosterone] results in decreased expression of IL12A mRNA CTD PMID:26496021 Il12a Mouse testosterone increases expression EXP 6480464 Testosterone results in increased expression of IL12A mRNA CTD PMID:19693291 Il12a Mouse thalidomide multiple interactions ISO IL12A (Homo sapiens) 6480464 Thalidomide results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:11788559 Il12a Mouse theophylline multiple interactions ISO IL12A (Homo sapiens) 6480464 Theophylline results in decreased expression of [IL12A protein binds to IL12B protein] CTD PMID:15569413 Il12a Mouse titanium dioxide increases expression ISO IL12A (Homo sapiens) 6480464 titanium dioxide results in increased expression of IL12A mRNA CTD PMID:19695317 Il12a Mouse toluene decreases expression EXP 6480464 Toluene results in decreased expression of IL12A mRNA CTD PMID:22057034 Il12a Mouse toluene affects expression EXP 6480464 Toluene affects the expression of IL12A mRNA CTD PMID:21601613 Il12a Mouse trichloroethene increases expression ISO Il12a (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of IL12A mRNA CTD PMID:33387578 Il12a Mouse trichostatin A multiple interactions ISO IL12A (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Lipopolysaccharides results in increased expression of IL12A mRNA] CTD PMID:12470611 Il12a Mouse trichostatin A increases expression ISO IL12A (Homo sapiens) 6480464 trichostatin A results in increased expression of IL12A mRNA CTD PMID:12470611 Il12a Mouse Triptolide multiple interactions ISO IL12A (Homo sapiens) 6480464 triptolide inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased expression of [IL12A protein binds to IL12B protein]] CTD PMID:15663903 Il12a Mouse tunicamycin multiple interactions ISO IL12A (Homo sapiens) 6480464 Tunicamycin inhibits the reaction [IL12A protein binds to IL12B protein] and Tunicamycin results in decreased secretion of [IL12A protein binds to IL12B protein] CTD PMID:10779781 Il12a Mouse tunicamycin decreases N-linked glycosylation ISO IL12A (Homo sapiens) 6480464 Tunicamycin results in decreased N-linked glycosylation of IL12A protein CTD PMID:10779781 Il12a Mouse urethane multiple interactions EXP 6480464 Freund's Adjuvant promotes the reaction [Urethane results in decreased expression of IL12A mRNA] CTD PMID:12810352 Il12a Mouse warfarin increases expression ISO Il12a (Rattus norvegicus) 6480464 Warfarin results in increased expression of IL12A mRNA CTD PMID:22342526 Il12a Mouse wortmannin multiple interactions ISO IL12A (Homo sapiens) 6480464 wortmannin inhibits the reaction [C5 protein results in decreased expression of [IL12A protein binds to IL12B protein]] more ... CTD PMID:16116186 Il12a Mouse zearalenone increases expression ISO IL12A (Homo sapiens) 6480464 Zearalenone results in increased expression of IL12A mRNA CTD PMID:36828454 Il12a Mouse zileuton multiple interactions ISO IL12A (Homo sapiens) 6480464 zileuton inhibits the reaction [Leukotriene D4 results in increased secretion of [IL12A protein binds to IL12B protein]] CTD PMID:19118273
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(S)-nicotine (EXP) 1,2-dichloroethane (EXP) 1-chloro-2,4-dinitrobenzene (EXP,ISO) 17beta-estradiol (EXP,ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP,ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3-bis(4-hydroxyphenyl)propionitrile (EXP) 2,4,6-trinitrobenzenesulfonic acid (EXP) 2-tert-butylhydroquinone (ISO) 3',5'-cyclic AMP (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3,3',5,5'-tetrabromobisphenol A (EXP) 3,5-diethoxycarbonyl-1,4-dihydrocollidine (EXP) 3-iodobenzyl-5'-N-methylcarboxamidoadenosine (ISO) 3-methylcholanthrene (ISO) 3-phenylprop-2-enal (EXP) 4,4'-sulfonyldiphenol (EXP) 4-methylhistamine (ISO) 4-nitroquinoline N-oxide (EXP) 7,12-dimethyltetraphene (EXP) 9-cis-retinoic acid (ISO) acetylsalicylic acid (ISO) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) Alpinetin (ISO) ammonium chloride (ISO) anthranilic acid (ISO) antimony(0) (EXP) apilimod (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (EXP,ISO) atorvastatin calcium (ISO) azathioprine (ISO) benzene (ISO) benzo[a]pyrene (EXP,ISO) benzo[a]pyrene diol epoxide I (ISO) Benzo[ghi]perylene (ISO) beta-D-glucan (ISO) beta-lapachone (ISO) beta-naphthoflavone (ISO) betulin (EXP) bisphenol A (EXP,ISO) bisphenol F (EXP) Butylbenzyl phthalate (EXP) cadmium atom (ISO) cadmium dichloride (EXP,ISO) caffeine (ISO) cannabidiol (EXP) carbamate ester (ISO) carbamazepine (EXP) carvedilol (ISO) casticin (ISO) CGS-21680 (ISO) chlorophyllin (EXP) chloroprene (EXP) cisplatin (ISO) clofibrate (EXP) colforsin daropate hydrochloride (EXP) copper atom (ISO) copper(0) (ISO) crocidolite asbestos (ISO) curcumin (ISO) cyclophosphamide (EXP) cyclosporin A (EXP,ISO) daidzein (EXP) deoxynivalenol (EXP,ISO) dexamethasone (EXP) dextran sulfate (EXP) diallyl trisulfide (ISO) diazinon (ISO) dichlorine (EXP) diltiazem (ISO) Dimaprit (ISO) dioxygen (ISO) doxorubicin (EXP) esketamine (ISO) estriol (EXP) ethanol (EXP) ethyl methanesulfonate (ISO) eugenol (EXP) famotidine (ISO) fumigaclavine C (EXP) fumonisin B1 (ISO) Ganoderic acid C2 (EXP) genistein (ISO) gentamycin (ISO) glucuronoxylomannan (ISO) glycyrrhizinic acid (EXP) helenalin (ISO) histamine (ISO) hydrogen peroxide (EXP) Ibudilast (EXP) imiquimod (EXP) indole-3-methanol (ISO) indometacin (EXP) iron atom (ISO) iron dichloride (ISO) iron(0) (ISO) isocyanates (ISO) isoniazide (ISO) isoprenaline (ISO) kainic acid (EXP) ketamine (ISO) lead diacetate (EXP) lead(0) (EXP) leukotriene D4 (ISO) lipid As (ISO) lipopolysaccharide (EXP,ISO) lupane (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (EXP,ISO) mangiferin (EXP) mechlorethamine (ISO) melphalan (ISO) mercury dichloride (EXP) metam (EXP) methotrexate (ISO) methyl 3,4,5-trihydroxybenzoate (EXP) methyl isothiocyanate (EXP) methyl methanesulfonate (ISO) MK-2206 (ISO) montelukast (ISO) morphine (EXP) muramyl dipeptide (ISO) N-acetyl-L-cysteine (EXP) N-nitrosodiethylamine (ISO) N1'-[2-[[5-[(dimethylamino)methyl]-2-furanyl]methylthio]ethyl]-N1-methyl-2-nitroethene-1,1-diamine (ISO) neocuproine (EXP) nickel sulfate (ISO) niclosamide (ISO) nicotine (EXP) nonanoic acid (EXP) Nutlin-3 (ISO) o-anisidine (ISO) ochratoxin A (ISO) ozone (EXP,ISO) paclitaxel (EXP) paracetamol (EXP) PCB138 (ISO) phorbol 12,13-dibutanoate (ISO) phorbol 13-acetate 12-myristate (EXP) pirinixic acid (EXP) poly(I:C) (ISO) polymyxin B2 (EXP) prednisone (ISO) pristane (EXP) progesterone (EXP,ISO) prostaglandin E2 (ISO) raloxifene (ISO) ranitidine (ISO) resiquimod (EXP,ISO) resveratrol (EXP,ISO) ribavirin (ISO) Ro 41-5253 (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 203580 (EXP,ISO) silicon dioxide (EXP) sirolimus (EXP) stattic (ISO) sulfasalazine (EXP) temozolomide (ISO) testosterone (EXP,ISO) thalidomide (ISO) theophylline (ISO) titanium dioxide (ISO) toluene (EXP) trichloroethene (ISO) trichostatin A (ISO) Triptolide (ISO) tunicamycin (ISO) urethane (EXP) warfarin (ISO) wortmannin (ISO) zearalenone (ISO) zileuton (ISO)
1.
Calcineurin inhibitors and the IL12A locus influence risk of recurrent primary biliary cirrhosis after liver transplantation.
Carbone M, etal., Am J Transplant. 2013 Apr;13(4):1110-1111. doi: 10.1111/ajt.12132. Epub 2013 Feb 22.
2.
IL12 Gene Polymorphism in Association with Hepatocellular Carcinoma in HCV-infected Egyptian Patients.
Elsayed HM, etal., Immunol Invest. 2017 Feb;46(2):123-133. doi: 10.1080/08820139.2016.1229789. Epub 2016 Nov 7.
3.
IL-12p35-deficient mice are susceptible to experimental autoimmune encephalomyelitis: evidence for redundancy in the IL-12 system in the induction of central nervous system autoimmune demyelination.
Gran B, etal., J Immunol 2002 Dec 15;169(12):7104-10.
4.
Primary biliary cirrhosis associated with HLA, IL12A, and IL12RB2 variants.
Hirschfield GM, etal., N Engl J Med. 2009 Jun 11;360(24):2544-55. doi: 10.1056/NEJMoa0810440. Epub 2009 May 20.
5.
Serum levels of Interleukins 1-Alpha & 12 as Predictors of Disease Progression in Hepatitis C Diabetic Patients.
Khalil M, etal., Egypt J Immunol. 2018 Jan;25(1):181-190.
6.
Association of IL12A Expression Quantitative Trait Loci (eQTL) With Primary Biliary Cirrhosis in a Chinese Han Population.
Li P, etal., Medicine (Baltimore). 2016 May;95(19):e3665. doi: 10.1097/MD.0000000000003665.
7.
IL12 polymorphisms, HBV infection and risk of hepatocellular carcinoma in a high-risk Chinese population.
Liu L, etal., Int J Cancer. 2011 Apr 1;128(7):1692-6. doi: 10.1002/ijc.25488. Epub 2010 Jun 2.
8.
IL-12 contributes to allergen-induced airway inflammation in experimental asthma.
Meyts I, etal., J Immunol. 2006 Nov 1;177(9):6460-70.
9.
MGDs mouse GO annotations
MGD data from the GO Consortium
10.
MGD IEA
MGD IEA
11.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
12.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
13.
Mouse MP Annotation Import Pipeline
RGD automated import pipeline
14.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
15.
Immunomodulatory effects of viral TLR ligands on experimental asthma depend on the additive effects of IL-12 and IL-10.
Sel S, etal., J Immunol. 2007 Jun 15;178(12):7805-13.
16.
Genetic variants in IL12 influence both hepatitis B virus clearance and HBV-related hepatocellular carcinoma development in a Chinese male population.
Tan A, etal., Tumour Biol. 2016 May;37(5):6343-8. doi: 10.1007/s13277-015-4520-x. Epub 2015 Dec 2.
17.
Up-regulation of IL-12 expression in patients with chronic hepatitis B is mediated by the PI3K/Akt pathway.
Wang HW, etal., Mol Cell Biochem. 2015 Sep;407(1-2):135-42. doi: 10.1007/s11010-015-2463-6. Epub 2015 Jun 11.
Il12a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 3 68,597,977 - 68,605,881 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 3 68,597,977 - 68,605,880 (+) Ensembl GRCm39 Ensembl GRCm38 3 68,690,644 - 68,698,550 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 3 68,690,644 - 68,698,547 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 3 68,494,566 - 68,502,469 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 3 68,778,573 - 68,786,454 (+) NCBI MGSCv36 mm8 Celera 3 68,820,603 - 68,828,506 (+) NCBI Celera Cytogenetic Map 3 E1 NCBI cM Map 3 31.92 NCBI
IL12A Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 159,988,835 - 159,996,019 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 159,988,835 - 159,996,019 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 159,706,622 - 159,713,806 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 161,189,323 - 161,196,500 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 3 161,189,330 - 161,196,507 NCBI Celera 3 158,128,398 - 158,135,579 (+) NCBI Celera Cytogenetic Map 3 q25.33 NCBI HuRef 3 157,102,994 - 157,110,193 (+) NCBI HuRef CHM1_1 3 159,669,641 - 159,676,836 (+) NCBI CHM1_1 T2T-CHM13v2.0 3 162,763,550 - 162,770,734 (+) NCBI T2T-CHM13v2.0
Il12a Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 155,275,734 - 155,282,997 (+) NCBI GRCr8 mRatBN7.2 2 152,965,769 - 152,973,035 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 152,965,769 - 152,972,734 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 160,091,860 - 160,098,803 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 158,142,380 - 158,149,321 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 152,775,143 - 152,782,090 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 165,076,945 - 165,083,996 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 165,076,607 - 165,084,318 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 184,430,744 - 184,437,696 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 158,710,261 - 158,717,689 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 158,660,223 - 158,667,652 (+) NCBI Celera 2 147,317,946 - 147,324,898 (+) NCBI Celera Cytogenetic Map 2 q32 NCBI
Il12a Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955448 10,611,131 - 10,617,911 (+) NCBI ChiLan1.0 ChiLan1.0
IL12A Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 157,926,204 - 157,935,673 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 157,930,880 - 157,942,229 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 157,011,675 - 157,019,897 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 165,061,505 - 165,068,666 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 165,061,505 - 165,068,666 (+) Ensembl panpan1.1 panPan2
IL12A Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 34 26,125,529 - 26,133,546 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 34 26,124,770 - 26,133,550 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 34 30,167,784 - 30,175,056 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 34 26,181,526 - 26,189,271 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 34 26,180,963 - 26,189,280 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 34 26,112,551 - 26,119,731 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 34 26,072,972 - 26,080,252 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 34 26,312,100 - 26,319,473 (+) NCBI UU_Cfam_GSD_1.0
Il12a Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 83,553,229 - 83,559,894 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936519 6,175,261 - 6,180,396 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936519 6,166,060 - 6,180,652 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
IL12A Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 99,733,394 - 99,741,078 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 99,733,394 - 99,741,078 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 108,066,792 - 108,074,477 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
IL12A Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 15 30,887,048 - 30,896,577 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 15 30,887,897 - 30,894,550 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 3,416,998 - 3,424,283 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Il12a
.
Predicted Target Of
Count of predictions: 296 Count of miRNA genes: 125 Interacting mature miRNAs: 133 Transcripts: ENSMUST00000029345, ENSMUST00000107816 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
4142399 Aec1_m autoimmune exocrinopathy 1 (mouse) Not determined 7586174 102690034 Mouse 14746977 Manh53_m mandible shape 53 (mouse) 3 35925280 69925280 Mouse 26884378 Skwq6_m skull length QTL 6, 10 week (mouse) 3 51907421 102307316 Mouse 1301971 Cia5_m collagen induced arthritis QTL 5 (mouse) Not determined 3 66046658 100046795 Mouse 1301585 Cd4ts1_m CD4 T cell subset 1 (mouse) Not determined 3 39704102 73704231 Mouse 4141116 Lgaq4_m late growth adjusted QTL 4 (mouse) Not determined 10249221 83184946 Mouse 4141563 Lgq3_m late growth QTL 3 (mouse) Not determined 10249221 83184946 Mouse 1357584 Splq6_m spleen weight QTL 6 (mouse) Not determined 3 10249221 83184946 Mouse 26884382 Bzwq1_m bi-zygomatic width QTL 1, 5 week (mouse) 3 52207421 137205761 Mouse 11041901 Lmr11b_m leishmaniasis resistance 11b (mouse) 3 39704102 73704231 Mouse 1357585 Manln3_m mandible length 3 (mouse) Not determined 3 52625509 86625745 Mouse 26884380 Skwq1_m skull length QTL 1, 5 week (mouse) 3 43954435 101607316 Mouse 13464139 Nhdlq17_m non-HDL QTL 17 (mouse) 3 52923183 86923183 Mouse 25314313 Syncl1_m synaptonemal complex length 1 (mouse) 3 67907333 128393649 Mouse 1300895 Hdl5_m HDL level 5 (mouse) Not determined 3 49495005 83495118 Mouse 26884436 Zlq3_m zygomatic length QTL 3, 10 week (mouse) 3 3265060 142405761 Mouse 1301917 Tshp4_m tooth shape 4 (mouse) Not determined 3 52625509 86625745 Mouse 26884427 Cvht4_m cranial vault height 4, 10 week (mouse) 3 16054164 109707316 Mouse 4141294 Bmd24_m bone mineral density 24 (mouse) Not determined 3 61740061 95740241 Mouse 1301824 Susp_m suppressor of superoxide production (mouse) Not determined 3 49495005 83495118 Mouse 1357440 Hrtpq1_m heart weight percentage QTL 1 (mouse) Not determined 3 10249221 83184946 Mouse 10755516 Amzn1_m anatomical modifier of Zfp423 1 (mouse) 3 39704102 73704231 Mouse 1558925 Hivan1_m HIV-associated nephropathy 1 (mouse) Not determined 3 7586174 68716946 Mouse 1301705 Sles3_m systemic lupus erythmatosus suppressor 3 (mouse) Not determined 3 37174862 143353183 Mouse 39128206 Lwq18_m liver weight QTL 18 (mouse) 3 10249221 83184946 Mouse 13207570 Tcq12_m total cholesterol QTL 12 (mouse) 3 16504164 130163649 Mouse 26884422 Cvht7_m cranial vault height 7, 16 week (mouse) 3 28954149 118893649 Mouse 1300593 Skull4_m skull morphology 4 (mouse) Not determined 3 52625509 86625745 Mouse 12880419 V125Dq4_m vitamin D active form serum level QTL 4 (mouse) 3 58907307 92907307 Mouse 4141079 Ath23_m atherosclerosis 23 (mouse) Not determined 49357581 83357581 Mouse 18337272 Bmd46_m bone mineral density 46, males (mouse) 3 35407421 69407421 Mouse 11039513 Ltpr3a_m Leishmania tropica response 3a (mouse) 3 39704102 73704231 Mouse 11039519 Ltpr3_m Leishmania tropica response 3 (mouse) 3 56704102 100464137 Mouse 4141255 W10q3_m weight 10 weeks QTL 3 (mouse) Not determined 10249221 83184946 Mouse 1300587 Aod2_m autoimmune ovarian dysgenesis 2 (mouse) Not determined 3 37179742 68716946 Mouse 1302056 Orgwq4_m organ weight QTL 4 (mouse) Not determined 3 30067588 147304689 Mouse 13208566 Bmiq5_m body mass index QTL 5 (mouse) 3 40954435 115793649 Mouse
M86672
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 3 68,698,173 - 68,698,320 UniSTS GRCm38 MGSCv37 3 68,502,095 - 68,502,242 UniSTS GRCm37 Celera 3 68,828,132 - 68,828,279 UniSTS Cytogenetic Map 3 E1 UniSTS cM Map 3 37.0 UniSTS Whitehead/MRC_RH 3 632.62 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000029345 ⟹ ENSMUSP00000029345
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,597,977 - 68,605,880 (+) Ensembl GRCm38.p6 Ensembl 3 68,690,644 - 68,698,547 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000107816 ⟹ ENSMUSP00000103446
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,598,685 - 68,605,876 (+) Ensembl GRCm38.p6 Ensembl 3 68,691,424 - 68,698,543 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000191910
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,601,326 - 68,605,356 (+) Ensembl GRCm38.p6 Ensembl 3 68,693,993 - 68,698,023 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000192812
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,601,354 - 68,605,878 (+) Ensembl GRCm38.p6 Ensembl 3 68,694,021 - 68,698,545 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000195408
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,598,860 - 68,605,424 (+) Ensembl GRCm38.p6 Ensembl 3 68,691,527 - 68,698,091 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000195517
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 3 68,601,354 - 68,605,880 (+) Ensembl GRCm38.p6 Ensembl 3 68,694,021 - 68,698,547 (+) Ensembl
RefSeq Acc Id:
NM_001159424 ⟹ NP_001152896
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,597,977 - 68,605,881 (+) NCBI GRCm38 3 68,690,644 - 68,698,550 (+) NCBI MGSCv37 3 68,494,566 - 68,502,469 (+) RGD Celera 3 68,820,603 - 68,828,509 (+) NCBI cM Map 3 ENTREZGENE
Sequence:
TGCCACCTACTCCCTTGGATCTGAGCTGGACCCTTGCATCTGGCGTCTACACTGCTGCTGAAATCTTCTCACCGTGCACATCCAAGGATATCTCTATGGTCAGCGTTCCAACAGCCTCACCCTCGGCA
hide sequence
RefSeq Acc Id:
NM_001410417 ⟹ NP_001397346
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,598,685 - 68,605,881 (+) NCBI
RefSeq Acc Id:
NM_001410418 ⟹ NP_001397347
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,599,263 - 68,605,881 (+) NCBI
RefSeq Acc Id:
NM_001410419 ⟹ NP_001397348
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,601,372 - 68,605,881 (+) NCBI
RefSeq Acc Id:
NM_001410420 ⟹ NP_001397349
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,601,074 - 68,605,881 (+) NCBI
RefSeq Acc Id:
NM_008351 ⟹ NP_032377
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 3 68,598,685 - 68,605,881 (+) NCBI GRCm38 3 68,691,424 - 68,698,550 (+) NCBI MGSCv37 3 68,494,566 - 68,502,469 (+) RGD Celera 3 68,820,603 - 68,828,509 (+) NCBI cM Map 3 ENTREZGENE
Sequence:
GCAAGAGACACAGTCCTGGGAAAGTCCTGCCGGCTATCCAGACAATTATAAAAATGTGTCTCCC
hide sequence
RefSeq Acc Id:
NP_032377 ⟸ NM_008351
- Peptide Label:
isoform 2 precursor
- UniProtKB:
P43431 (UniProtKB/Swiss-Prot), Q549G3 (UniProtKB/TrEMBL), F8WI71 (UniProtKB/TrEMBL)
- Sequence:
MCQSRYLLFLATLALLNHLSLARVIPVSGPARCLSQSRNLLKTTDDMVKTAREKLKHYSCTAEDIDHEDITRDQTSTLKTCLPLELHKNESCLATRETSSTTRGSCLPPQKTSLMMTLCLGSIYEDLK
hide sequence
RefSeq Acc Id:
NP_001152896 ⟸ NM_001159424
- Peptide Label:
isoform 2 precursor
- UniProtKB:
P43431 (UniProtKB/Swiss-Prot), Q549G3 (UniProtKB/TrEMBL), F8WI71 (UniProtKB/TrEMBL)
- Sequence:
MVSVPTASPSASSSSSQCRSSMCQSRYLLFLATLALLNHLSLARVIPVSGPARCLSQSRNLLKTTDDMVKTAREKLKHYSCTAEDIDHEDITRDQTSTLKTCLPLELHKNESCLATRETSSTTRGSCL
hide sequence
Ensembl Acc Id:
ENSMUSP00000029345 ⟸ ENSMUST00000029345
Ensembl Acc Id:
ENSMUSP00000103446 ⟸ ENSMUST00000107816
RefSeq Acc Id:
NP_001397346 ⟸ NM_001410417
- Peptide Label:
isoform 3 precursor
- UniProtKB:
F8WI71 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001397347 ⟸ NM_001410418
- Peptide Label:
isoform 4
RefSeq Acc Id:
NP_001397349 ⟸ NM_001410420
- Peptide Label:
isoform 5
RefSeq Acc Id:
NP_001397348 ⟸ NM_001410419
- Peptide Label:
isoform 5
RGD ID: 6880852 Promoter ID: EPDNEW_M3877 Type: initiation region Name: Il12a_1 Description: Mus musculus interleukin 12a , transcript variant 2, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 3 68,691,381 - 68,691,441 EPDNEW
