Symbol:
Nptx1
Name:
neuronal pentraxin 1
RGD ID:
628894
Description:
Predicted to enable metal ion binding activity. Involved in several processes, including mitochondrial fragmentation involved in apoptotic process; neurotransmitter receptor localization to postsynaptic specialization membrane; and postsynaptic density assembly. Is active in glutamatergic synapse and synaptic cleft. Human ortholog(s) of this gene implicated in autosomal dominant cerebellar ataxia. Orthologous to human NPTX1 (neuronal pentraxin 1); INTERACTS WITH (S)-colchicine; 1,2,4-trimethylbenzene; 1,3,5-trinitro-1,3,5-triazinane.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
47 kDa taipoxin-binding protein; LOC360249; neuronal pentraxin I; neuronal pentraxin-1; NP-I; NP1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
NPTX1 (neuronal pentraxin 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Nptx1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Nptx1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
NPTX1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
NPTX1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Nptx1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
NPTX1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
NPTX1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Nptx1 (neuronal pentraxin 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
NPTX1 (neuronal pentraxin 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Nptx1 (neuronal pentraxin 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
nptx1l (neuronal pentraxin 1 like)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
nptx1
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 105,309,578 - 105,318,829 (-) NCBI GRCr8 mRatBN7.2 10 104,811,107 - 104,820,358 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 104,811,403 - 104,820,367 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 109,914,282 - 109,923,567 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 109,377,316 - 109,386,601 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 104,731,702 - 104,740,953 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 108,682,637 - 108,691,592 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 108,682,638 - 108,691,367 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 108,286,989 - 108,295,944 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 108,918,661 - 108,927,616 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 103,356,568 - 103,365,489 (-) NCBI Celera Cytogenetic Map 10 q32.3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Nptx1 Rat (S)-colchicine increases expression EXP 6480464 Colchicine results in increased expression of NPTX1 mRNA CTD PMID:18255150 Nptx1 Rat 1,2,4-trimethylbenzene increases expression EXP 6480464 pseudocumene results in increased expression of NPTX1 protein CTD PMID:17337753 Nptx1 Rat 1,3,5-trinitro-1,3,5-triazinane decreases expression EXP 6480464 cyclonite results in decreased expression of NPTX1 mRNA CTD PMID:25559034 Nptx1 Rat 17beta-estradiol increases expression ISO NPTX1 (Homo sapiens) 6480464 Estradiol results in increased expression of NPTX1 mRNA CTD PMID:31614463 Nptx1 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Nptx1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Nptx1 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Nptx1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Nptx1 Rat 2,2',5,5'-tetrachlorobiphenyl decreases expression ISO NPTX1 (Homo sapiens) 6480464 2 more ... CTD PMID:36804509 Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Nptx1 (Mus musculus) 6480464 [TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in increased expression of NPTX1 mRNA and AHR protein affects the reaction [Tetrachlorodibenzodioxin results in increased expression of NPTX1 mRNA] CTD PMID:16214954 and PMID:25975270 Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Nptx1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of NPTX1 mRNA CTD PMID:16214954 more ... Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Nptx1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of NPTX1 mRNA CTD PMID:26377647 Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO NPTX1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of NPTX1 mRNA CTD PMID:22262711 and PMID:25445724 Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO NPTX1 (Homo sapiens) 6480464 AHR gene SNP affects the reaction [Tetrachlorodibenzodioxin results in increased expression of NPTX1 mRNA] CTD PMID:25445724 Nptx1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of NPTX1 mRNA CTD PMID:22808131 more ... Nptx1 Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Nptx1 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression ISO NPTX1 (Homo sapiens) 6480464 2 more ... CTD PMID:26705709 Nptx1 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO NPTX1 (Homo sapiens) 6480464 3 more ... CTD PMID:22262711 Nptx1 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO NPTX1 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of NPTX1 mRNA CTD PMID:33476716 Nptx1 Rat 4,4'-sulfonyldiphenol increases expression ISO Nptx1 (Mus musculus) 6480464 bisphenol S results in increased expression of NPTX1 mRNA CTD PMID:30951980 Nptx1 Rat 4,4'-sulfonyldiphenol affects methylation ISO Nptx1 (Mus musculus) 6480464 bisphenol S affects the methylation of NPTX1 gene CTD PMID:31683443 Nptx1 Rat 5-aza-2'-deoxycytidine affects expression ISO NPTX1 (Homo sapiens) 6480464 Decitabine affects the expression of NPTX1 mRNA CTD PMID:23300844 Nptx1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of NPTX1 mRNA CTD PMID:24780913 Nptx1 Rat 6-propyl-2-thiouracil multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Propylthiouracil co-treated with Iodine deficiency] results in decreased expression of NPTX1 mRNA CTD PMID:36706583 Nptx1 Rat 7,12-dimethyltetraphene increases expression EXP 6480464 9 more ... CTD PMID:19480007 Nptx1 Rat Aflatoxin B2 alpha increases methylation ISO NPTX1 (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of NPTX1 intron CTD PMID:30157460 Nptx1 Rat all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of NPTX1 mRNA CTD PMID:20488242 Nptx1 Rat all-trans-retinoic acid increases expression ISO NPTX1 (Homo sapiens) 6480464 Tretinoin results in increased expression of NPTX1 mRNA CTD PMID:23724009 Nptx1 Rat amitrole decreases expression EXP 6480464 Amitrole results in decreased expression of NPTX1 mRNA CTD PMID:38685447 Nptx1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of NPTX1 mRNA CTD PMID:16483693 Nptx1 Rat antimycin A increases expression ISO NPTX1 (Homo sapiens) 6480464 Antimycin A results in increased expression of NPTX1 mRNA CTD PMID:33512557 Nptx1 Rat aristolochic acid A increases expression ISO NPTX1 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of NPTX1 mRNA CTD PMID:33212167 Nptx1 Rat arsane decreases expression ISO Nptx1 (Mus musculus) 6480464 Arsenic results in decreased expression of NPTX1 mRNA CTD PMID:19654921 Nptx1 Rat arsenic atom decreases expression ISO Nptx1 (Mus musculus) 6480464 Arsenic results in decreased expression of NPTX1 mRNA CTD PMID:19654921 Nptx1 Rat benzene-1,2,4-triol decreases expression ISO NPTX1 (Homo sapiens) 6480464 hydroxyhydroquinone results in decreased expression of NPTX1 mRNA CTD PMID:39245080 Nptx1 Rat benzo[a]pyrene increases mutagenesis ISO NPTX1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased mutagenesis of NPTX1 gene CTD PMID:25435355 Nptx1 Rat benzo[a]pyrene affects methylation ISO NPTX1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of NPTX1 3' UTR CTD PMID:27901495 Nptx1 Rat benzo[a]pyrene increases methylation ISO NPTX1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of NPTX1 5' UTR more ... CTD PMID:27901495 Nptx1 Rat benzo[a]pyrene multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with Dextran Sulfate] results in increased expression of NPTX1 mRNA CTD PMID:26271895 Nptx1 Rat benzo[a]pyrene decreases expression ISO NPTX1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of NPTX1 mRNA CTD PMID:22178795 Nptx1 Rat benzo[a]pyrene diol epoxide I increases expression ISO NPTX1 (Homo sapiens) 6480464 7 more ... CTD PMID:20382639 Nptx1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO NPTX1 (Homo sapiens) 6480464 Diethylhexyl Phthalate results in decreased expression of NPTX1 mRNA CTD PMID:31163220 Nptx1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of NPTX1 mRNA CTD PMID:25181051 Nptx1 Rat bisphenol A increases expression ISO Nptx1 (Mus musculus) 6480464 bisphenol A results in increased expression of NPTX1 mRNA CTD PMID:30951980 Nptx1 Rat bisphenol A increases expression ISO NPTX1 (Homo sapiens) 6480464 bisphenol A results in increased expression of NPTX1 mRNA CTD PMID:29275510 Nptx1 Rat bisphenol A decreases methylation ISO Nptx1 (Mus musculus) 6480464 bisphenol A results in decreased methylation of NPTX1 promoter CTD PMID:27312807 Nptx1 Rat bisphenol A decreases expression ISO NPTX1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of NPTX1 mRNA CTD PMID:27685785 and PMID:33476716 Nptx1 Rat bisphenol F increases expression ISO Nptx1 (Mus musculus) 6480464 bisphenol F results in increased expression of NPTX1 mRNA CTD PMID:30951980 Nptx1 Rat boron nitride decreases expression ISO NPTX1 (Homo sapiens) 6480464 boron nitride results in decreased expression of NPTX1 mRNA CTD PMID:30644070 Nptx1 Rat bortezomib decreases expression ISO NPTX1 (Homo sapiens) 6480464 Bortezomib results in decreased expression of NPTX1 mRNA CTD PMID:20977926 Nptx1 Rat butan-1-ol multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [[Gasoline co-treated with 1-Butanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of NPTX1 mRNA CTD PMID:29432896 Nptx1 Rat butanal increases expression ISO NPTX1 (Homo sapiens) 6480464 butyraldehyde results in increased expression of NPTX1 mRNA CTD PMID:26079696 Nptx1 Rat cadmium dichloride decreases expression ISO NPTX1 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of NPTX1 mRNA CTD PMID:38382870 Nptx1 Rat chlordecone increases expression ISO Nptx1 (Mus musculus) 6480464 Chlordecone results in increased expression of NPTX1 mRNA CTD PMID:33711761 Nptx1 Rat chlorpyrifos increases expression ISO Nptx1 (Mus musculus) 6480464 Chlorpyrifos results in increased expression of NPTX1 mRNA CTD PMID:37019170 Nptx1 Rat chromium(6+) multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [zinc chromate results in increased abundance of chromium hexavalent ion] which results in decreased expression of NPTX1 mRNA CTD PMID:38479592 Nptx1 Rat cisplatin affects expression ISO NPTX1 (Homo sapiens) 6480464 Cisplatin affects the expression of NPTX1 mRNA CTD PMID:23300844 Nptx1 Rat cisplatin increases expression ISO NPTX1 (Homo sapiens) 6480464 Cisplatin results in increased expression of NPTX1 mRNA CTD PMID:27392435 Nptx1 Rat copper(II) sulfate affects expression ISO NPTX1 (Homo sapiens) 6480464 Copper Sulfate affects the expression of NPTX1 mRNA CTD PMID:19549813 Nptx1 Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of NPTX1 mRNA CTD PMID:26577399 Nptx1 Rat cyclosporin A decreases expression ISO NPTX1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of NPTX1 mRNA CTD PMID:22147139 Nptx1 Rat deguelin decreases expression ISO NPTX1 (Homo sapiens) 6480464 deguelin results in decreased expression of NPTX1 mRNA CTD PMID:33512557 Nptx1 Rat dextran sulfate multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with Dextran Sulfate] results in increased expression of NPTX1 mRNA CTD PMID:26271895 Nptx1 Rat dibenzofurans increases expression ISO Nptx1 (Mus musculus) 6480464 Dibenzofurans results in increased expression of NPTX1 mRNA CTD PMID:34254344 Nptx1 Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of NPTX1 mRNA CTD PMID:32028152 Nptx1 Rat dichloroacetic acid decreases expression ISO Nptx1 (Mus musculus) 6480464 Dichloroacetic Acid results in decreased expression of NPTX1 mRNA CTD PMID:28962523 Nptx1 Rat diiodine multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Propylthiouracil co-treated with Iodine deficiency] results in decreased expression of NPTX1 mRNA CTD PMID:36706583 Nptx1 Rat dioxygen increases expression ISO NPTX1 (Homo sapiens) 6480464 Oxygen deficiency results in increased expression of NPTX1 mRNA CTD PMID:24236059 and PMID:26516004 Nptx1 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of NPTX1 mRNA CTD PMID:33729688 Nptx1 Rat dorsomorphin multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Nptx1 Rat doxorubicin affects expression ISO NPTX1 (Homo sapiens) 6480464 Doxorubicin affects the expression of NPTX1 mRNA CTD PMID:29803840 Nptx1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of NPTX1 mRNA CTD PMID:29391264 Nptx1 Rat entinostat increases expression ISO NPTX1 (Homo sapiens) 6480464 entinostat results in increased expression of NPTX1 mRNA CTD PMID:26272509 Nptx1 Rat entinostat multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of NPTX1 mRNA CTD PMID:27188386 Nptx1 Rat ethanol multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of NPTX1 mRNA CTD PMID:29432896 Nptx1 Rat ethanol affects splicing ISO Nptx1 (Mus musculus) 6480464 Ethanol affects the splicing of NPTX1 mRNA CTD PMID:30319688 Nptx1 Rat hydrogen peroxide increases expression ISO NPTX1 (Homo sapiens) 6480464 Hydrogen Peroxide results in increased expression of NPTX1 mRNA and Hydrogen Peroxide results in increased expression of NPTX1 protein CTD PMID:32949572 Nptx1 Rat iron dichloride decreases expression ISO NPTX1 (Homo sapiens) 6480464 ferrous chloride results in decreased expression of NPTX1 mRNA CTD PMID:35984750 Nptx1 Rat isobutanol multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [[Gasoline co-treated with isobutyl alcohol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of NPTX1 mRNA CTD PMID:29432896 Nptx1 Rat ivermectin decreases expression ISO NPTX1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of NPTX1 protein CTD PMID:32959892 Nptx1 Rat lead(0) affects expression ISO NPTX1 (Homo sapiens) 6480464 Lead affects the expression of NPTX1 mRNA CTD PMID:28903495 Nptx1 Rat lipopolysaccharide multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in decreased expression of NPTX1 mRNA CTD PMID:35811015 Nptx1 Rat mercury dibromide multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of NPTX1 mRNA CTD PMID:27188386 Nptx1 Rat methylisothiazolinone increases expression ISO NPTX1 (Homo sapiens) 6480464 2-methyl-4-isothiazolin-3-one results in increased expression of NPTX1 mRNA CTD PMID:31629900 Nptx1 Rat monosodium L-glutamate multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Trans Fatty Acids co-treated with Sodium Glutamate] results in increased expression of NPTX1 mRNA CTD PMID:22078008 Nptx1 Rat N-nitrosodiethylamine multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in increased expression of NPTX1 mRNA CTD PMID:24535843 Nptx1 Rat naphthalenes increases expression EXP 6480464 Naphthalenes results in increased expression of NPTX1 protein CTD PMID:17337753 Nptx1 Rat ozone multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of NPTX1 mRNA CTD PMID:34911549 Nptx1 Rat p-chloromercuribenzoic acid decreases expression ISO NPTX1 (Homo sapiens) 6480464 p-Chloromercuribenzoic Acid results in decreased expression of NPTX1 mRNA CTD PMID:26272509 Nptx1 Rat p-chloromercuribenzoic acid multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of NPTX1 mRNA CTD PMID:27188386 Nptx1 Rat PCB138 multiple interactions ISO Nptx1 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Nptx1 Rat pentanal increases expression ISO NPTX1 (Homo sapiens) 6480464 pentanal results in increased expression of NPTX1 mRNA CTD PMID:26079696 Nptx1 Rat perfluorooctanoic acid increases expression EXP 6480464 perfluorooctanoic acid results in increased expression of NPTX1 mRNA CTD PMID:35163327 Nptx1 Rat phenobarbital multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in increased expression of NPTX1 mRNA and NR1I3 protein affects the reaction [Phenobarbital results in increased expression of NPTX1 mRNA] CTD PMID:19482888 and PMID:24535843 Nptx1 Rat phenobarbital increases expression ISO Nptx1 (Mus musculus) 6480464 Phenobarbital results in increased expression of NPTX1 mRNA CTD PMID:19482888 Nptx1 Rat phenylmercury acetate decreases expression ISO NPTX1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in decreased expression of NPTX1 mRNA CTD PMID:26272509 Nptx1 Rat phenylmercury acetate multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of NPTX1 mRNA CTD PMID:27188386 Nptx1 Rat picoxystrobin decreases expression ISO NPTX1 (Homo sapiens) 6480464 picoxystrobin results in decreased expression of NPTX1 mRNA CTD PMID:33512557 Nptx1 Rat propanal increases expression ISO NPTX1 (Homo sapiens) 6480464 propionaldehyde results in increased expression of NPTX1 mRNA CTD PMID:26079696 Nptx1 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in decreased expression of NPTX1 mRNA CTD PMID:35811015 Nptx1 Rat SB 431542 multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Nptx1 Rat serpentine asbestos increases expression ISO NPTX1 (Homo sapiens) 6480464 Asbestos and Serpentine results in increased expression of NPTX1 mRNA CTD PMID:29523930 Nptx1 Rat sevoflurane decreases expression ISO Nptx1 (Mus musculus) 6480464 Sevoflurane results in decreased expression of NPTX1 mRNA CTD PMID:33928466 Nptx1 Rat silicon dioxide increases expression ISO NPTX1 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of NPTX1 mRNA CTD PMID:23806026 Nptx1 Rat sotorasib multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of NPTX1 mRNA CTD PMID:36139627 Nptx1 Rat succimer multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in increased expression of NPTX1 mRNA CTD PMID:26378955 Nptx1 Rat succimer multiple interactions ISO Nptx1 (Mus musculus) 6480464 [Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of NPTX1 mRNA CTD PMID:26378955 Nptx1 Rat sulforaphane decreases expression ISO Nptx1 (Mus musculus) 6480464 sulforaphane results in decreased expression of NPTX1 mRNA CTD PMID:30529165 Nptx1 Rat sulforaphane decreases expression ISO NPTX1 (Homo sapiens) 6480464 sulforaphane results in decreased expression of NPTX1 mRNA CTD PMID:31838189 Nptx1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of NPTX1 mRNA CTD PMID:34492290 Nptx1 Rat titanium dioxide decreases methylation ISO Nptx1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of NPTX1 gene CTD PMID:35295148 Nptx1 Rat titanium dioxide increases methylation ISO Nptx1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of NPTX1 promoter CTD PMID:35295148 Nptx1 Rat trametinib multiple interactions ISO NPTX1 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of NPTX1 mRNA CTD PMID:36139627 Nptx1 Rat trichloroethene decreases expression ISO Nptx1 (Mus musculus) 6480464 Trichloroethylene results in decreased expression of NPTX1 mRNA CTD PMID:28973375 Nptx1 Rat triclosan increases expression ISO NPTX1 (Homo sapiens) 6480464 Triclosan results in increased expression of NPTX1 mRNA CTD PMID:30510588 Nptx1 Rat triptonide increases expression ISO Nptx1 (Mus musculus) 6480464 triptonide results in increased expression of NPTX1 mRNA CTD PMID:33045310 Nptx1 Rat undecane increases expression EXP 6480464 undecane results in increased expression of NPTX1 protein CTD PMID:17337753 Nptx1 Rat valproic acid increases expression ISO NPTX1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of NPTX1 mRNA CTD PMID:23179753 and PMID:28001369 Nptx1 Rat valproic acid increases methylation ISO NPTX1 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of NPTX1 gene CTD PMID:29154799 Nptx1 Rat valproic acid affects expression ISO NPTX1 (Homo sapiens) 6480464 Valproic Acid affects the expression of NPTX1 mRNA CTD PMID:25979313 Nptx1 Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of NPTX1 mRNA CTD PMID:29427782
(S)-colchicine (EXP) 1,2,4-trimethylbenzene (EXP) 1,3,5-trinitro-1,3,5-triazinane (EXP) 17beta-estradiol (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 4,4'-sulfonyldiphenol (ISO) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP,ISO) 7,12-dimethyltetraphene (EXP) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (EXP,ISO) amitrole (EXP) ammonium chloride (EXP) antimycin A (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) benzene-1,2,4-triol (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) boron nitride (ISO) bortezomib (ISO) butan-1-ol (ISO) butanal (ISO) cadmium dichloride (ISO) chlordecone (ISO) chlorpyrifos (ISO) chromium(6+) (ISO) cisplatin (ISO) copper(II) sulfate (ISO) Cuprizon (EXP) cyclosporin A (ISO) deguelin (ISO) dextran sulfate (ISO) dibenzofurans (ISO) dibutyl phthalate (EXP) dichloroacetic acid (ISO) diiodine (ISO) dioxygen (EXP,ISO) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) entinostat (ISO) ethanol (ISO) hydrogen peroxide (ISO) iron dichloride (ISO) isobutanol (ISO) ivermectin (ISO) lead(0) (ISO) lipopolysaccharide (ISO) mercury dibromide (ISO) methylisothiazolinone (ISO) monosodium L-glutamate (ISO) N-nitrosodiethylamine (ISO) naphthalenes (EXP) ozone (ISO) p-chloromercuribenzoic acid (ISO) PCB138 (ISO) pentanal (ISO) perfluorooctanoic acid (EXP) phenobarbital (ISO) phenylmercury acetate (ISO) picoxystrobin (ISO) propanal (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) serpentine asbestos (ISO) sevoflurane (ISO) silicon dioxide (ISO) sotorasib (ISO) succimer (ISO) sulforaphane (ISO) thioacetamide (EXP) titanium dioxide (ISO) trametinib (ISO) trichloroethene (ISO) triclosan (ISO) triptonide (ISO) undecane (EXP) valproic acid (EXP,ISO)
1.
NP1 regulates neuronal activity-dependent accumulation of BAX in mitochondria and mitochondrial dynamics.
Clayton KB, etal., J Neurosci. 2012 Jan 25;32(4):1453-66.
2.
Astrocyte-Secreted Glypican 4 Regulates Release of Neuronal Pentraxin 1 from Axons to Induce Functional Synapse Formation.
Farhy-Tselnicker I, etal., Neuron. 2017 Oct 11;96(2):428-445.e13. doi: 10.1016/j.neuron.2017.09.053.
3.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
4.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
5.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
6.
GOA pipeline
RGD automated data pipeline
7.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
8.
Neuronal pentraxin, a secreted protein with homology to acute phase proteins of the immune system.
Schlimgen AK, etal., Neuron 1995 Mar;14(3):519-26.
9.
Modulation of Neuronal Pentraxin 1 Expression in Rat Pancreatic beta-Cells Submitted to Chronic Glucotoxic Stress.
Schvartz D, etal., Mol Cell Proteomics. 2012 Aug;11(8):244-54. Epub 2012 Mar 16.
Nptx1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 105,309,578 - 105,318,829 (-) NCBI GRCr8 mRatBN7.2 10 104,811,107 - 104,820,358 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 104,811,403 - 104,820,367 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 109,914,282 - 109,923,567 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 109,377,316 - 109,386,601 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 104,731,702 - 104,740,953 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 108,682,637 - 108,691,592 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 108,682,638 - 108,691,367 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 108,286,989 - 108,295,944 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 108,918,661 - 108,927,616 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 103,356,568 - 103,365,489 (-) NCBI Celera Cytogenetic Map 10 q32.3 NCBI
NPTX1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 80,466,834 - 80,476,607 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 80,466,834 - 80,477,843 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 78,440,634 - 78,450,407 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 76,055,228 - 76,064,999 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 76,055,227 - 76,064,999 NCBI Celera 17 75,069,005 - 75,078,529 (-) NCBI Celera Cytogenetic Map 17 q25.3 NCBI HuRef 17 73,878,650 - 73,888,424 (-) NCBI HuRef CHM1_1 17 78,526,902 - 78,536,673 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 81,368,723 - 81,378,497 (-) NCBI T2T-CHM13v2.0
Nptx1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 119,429,545 - 119,438,646 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 119,429,545 - 119,438,579 (-) Ensembl GRCm39 Ensembl GRCm38 11 119,538,719 - 119,547,820 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 119,538,719 - 119,547,753 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 119,400,033 - 119,409,134 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 119,355,462 - 119,363,915 (-) NCBI MGSCv36 mm8 Celera 11 131,286,494 - 131,295,595 (-) NCBI Celera Cytogenetic Map 11 E2 NCBI cM Map 11 83.95 NCBI
Nptx1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955506 2,447,109 - 2,456,965 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955506 2,447,429 - 2,456,612 (+) NCBI ChiLan1.0 ChiLan1.0
NPTX1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 97,048,221 - 97,057,994 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 101,948,062 - 101,957,835 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 74,896,150 - 74,905,917 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 80,629,443 - 80,638,376 (-) NCBI panpan1.1 PanPan1.1 panPan2
NPTX1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 1,388,728 - 1,398,115 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 1,388,407 - 1,399,390 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 2,006,248 - 2,015,635 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 1,998,099 - 2,007,496 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 1,998,127 - 2,007,488 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 2,021,740 - 2,031,119 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 2,147,267 - 2,156,623 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 2,228,148 - 2,237,541 (+) NCBI UU_Cfam_GSD_1.0
Nptx1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 2,027,566 - 2,038,459 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936594 4,373,473 - 4,384,461 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936594 4,373,500 - 4,384,394 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NPTX1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 2,036,810 - 2,046,193 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 2,036,727 - 2,046,202 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 1,938,606 - 1,948,101 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
NPTX1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 72,438,728 - 72,449,205 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 72,439,482 - 72,449,139 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 43,751,846 - 43,761,582 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Nptx1
.
Predicted Target Of
Count of predictions: 48 Count of miRNA genes: 45 Interacting mature miRNAs: 48 Transcripts: ENSRNOT00000005067 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 12880384 Cm107 Cardiac mass QTL 107 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 90404397 107211142 Rat 12880385 Cm108 Cardiac mass QTL 108 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 90404397 107211142 Rat 1354641 Bvd2 Brain ventricular dilatation QTL 2 6.36 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 10 93223816 107057807 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 2303589 Bw87 Body weight QTL 87 2 body mass (VT:0001259) body weight (CMO:0000012) 10 81285008 107211142 Rat 12880396 Am13 Aortic mass QTL 13 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 90404397 107211142 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 12880398 Kidm67 Kidney mass QTL 67 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 10 90404397 107211142 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 12880395 Cm109 Cardiac mass QTL 109 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 10 90404397 107211142 Rat 1579915 Bp280 Blood pressure QTL 280 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90404397 107211142 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 2298548 Neuinf7 Neuroinflammation QTL 7 3.4 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 10 72224939 107211142 Rat 1302404 Cia27 Collagen induced arthritis QTL 27 2.6 0.0045 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 10 76452683 107211142 Rat 2317754 Glom25 Glomerulus QTL 25 3.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 82685200 107211142 Rat 634320 Niddm49 Non-insulin dependent diabetes mellitus QTL 49 4.41 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 10 88539139 107211142 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 4889492 Pancm2 Pancreatic morphology QTL 2 3.2 pancreatic beta cell morphology trait (VT:0005217) ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814) 10 76748906 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 10450493 Bp382 Blood pressure QTL 382 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 1578672 Bmd16 Bone mineral density QTL 16 6.2 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 10 96703043 107057807 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 70193 Mcs7 Mammary carcinoma susceptibility QTL 7 2.38 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 72224939 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 61363 Oia3 Oil induced arthritis QTL 3 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87307617 107211142 Rat 2292438 Bp311 Blood pressure QTL 311 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 107211142 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 2292436 Bp310 Blood pressure QTL 310 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 94759759 107211142 Rat 724530 Bp149 Blood pressure QTL 149 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 90627439 107211142 Rat 1300137 Bp186 Blood pressure QTL 186 3.57 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 10 90627439 107057807 Rat 631538 Oia5 Oil induced arthritis QTL 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87055121 107211142 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 1578663 Bss18 Bone structure and strength QTL 18 3.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 10 96703043 107057807 Rat
Nptx1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 104,811,149 - 104,811,263 (+) MAPPER mRatBN7.2 Rnor_6.0 10 108,682,384 - 108,682,497 NCBI Rnor6.0 Rnor_5.0 10 108,286,736 - 108,286,849 UniSTS Rnor5.0 RGSC_v3.4 10 108,918,408 - 108,918,521 UniSTS RGSC3.4 Celera 10 103,356,315 - 103,356,428 UniSTS Cytogenetic Map 10 q32.3 UniSTS
RH143293
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 104,811,580 - 104,811,721 (+) MAPPER mRatBN7.2 Rnor_6.0 10 108,682,815 - 108,682,955 NCBI Rnor6.0 Rnor_5.0 10 108,287,167 - 108,287,307 UniSTS Rnor5.0 RGSC_v3.4 10 108,918,839 - 108,918,979 UniSTS RGSC3.4 Celera 10 103,356,746 - 103,356,886 UniSTS Cytogenetic Map 10 q32.3 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
45
113
62
61
30
25
30
6
185
93
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000005067 ⟹ ENSRNOP00000005067
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 104,811,403 - 104,820,367 (-) Ensembl Rnor_6.0 Ensembl 10 108,682,638 - 108,691,367 (-) Ensembl
RefSeq Acc Id:
NM_153735 ⟹ NP_714957
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 105,309,578 - 105,318,829 (-) NCBI mRatBN7.2 10 104,811,107 - 104,820,358 (-) NCBI Rnor_6.0 10 108,682,637 - 108,691,592 (-) NCBI Rnor_5.0 10 108,286,989 - 108,295,944 (-) NCBI RGSC_v3.4 10 108,918,661 - 108,927,616 (-) RGD Celera 10 103,356,568 - 103,365,489 (-) RGD
Sequence:
GGCAGTGGGGGCCGAGGAGCGCGGCCGAGAAGACCGTGCAGCGGAGAAGCGGGGTGCCAAGAGCGCGGGCCGCCTGCGGAGCGACTGCCCCAGCCAGCCGGATCCCGGTCTCAGCCCGAGCCCCACCG
hide sequence
RefSeq Acc Id:
NP_714957 ⟸ NM_153735
- Peptide Label:
precursor
- UniProtKB:
P47971 (UniProtKB/Swiss-Prot), A6HL92 (UniProtKB/TrEMBL), A0A0H2UHC1 (UniProtKB/TrEMBL)
- Sequence:
MLAGRAARTCALLALCLLGSRAQDFGPTRFICTSVPVDADMCAASVAAGGAEELRSNVLQLRETVLQQKETILSQKETIRELTTKLGRCESQSTLDAGPGEARSGGGRKQPGSGKNTMGDLSRTPASE
hide sequence
Ensembl Acc Id:
ENSRNOP00000005067 ⟸ ENSRNOT00000005067
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-03-22
Nptx1
neuronal pentraxin 1
Nptx1
neuronal pentraxin I
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2012-01-19
Nptx1
neuronal pentraxin I
Nptx1
neuronal pentraxin 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-02-23
Nptx1
neuronal pentraxin 1
Nptx1_predicted
neuronal pentraxin 1 (predicted)
Data merged from RGD:1310581
737654 APPROVED
2005-01-20
Nptx1
neuronal pentraxin 1
Symbol and Name status set to approved
1299863 APPROVED
2005-01-12
Nptx1_predicted
neuronal pentraxin 1 (predicted)
Symbol and Name status set to provisional
70820 PROVISIONAL
2003-02-27
Nptx1
neuronal pentraxin 1
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
expressed in neurons of cerebellum, hippocampus, and cerebral cortex
729007
