Symbol:
Mir330
Name:
microRNA 330
RGD ID:
2325620
Description:
Predicted to act upstream of or within several processes, including cellular response to forskolin; juxtaglomerular apparatus development; and long-term synaptic potentiation. Orthologous to human MIR330 (microRNA 330); INTERACTS WITH 2,5-hexanedione; atrazine; bleomycin A2.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
microRNA mir-330; rno-mir-330
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 87,961,207 - 87,961,303 (+) NCBI GRCr8 mRatBN7.2 1 78,833,178 - 78,833,274 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 78,833,178 - 78,833,274 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 84,222,262 - 84,222,358 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 92,779,863 - 92,779,959 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 85,977,353 - 85,977,449 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 80,092,681 - 80,092,777 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 80,092,681 - 80,092,777 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 81,358,760 - 81,358,856 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 1 73,298,803 - 73,298,899 (+) NCBI Celera Cytogenetic Map 1 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mir330 Rat 1,3,5-trinitro-1,3,5-triazinane decreases expression ISO Mir330 (Mus musculus) 6480464 cyclonite results in decreased expression of MIR330 mRNA modified form CTD PMID:19270793 Mir330 Rat 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine decreases expression ISO Mir330 (Mus musculus) 6480464 1-Methyl-4-phenyl-1 more ... CTD PMID:29071302 Mir330 Rat 17beta-estradiol decreases expression ISO MIR330 (Homo sapiens) 6480464 Estradiol results in decreased expression of MIR330 mRNA CTD PMID:24877718 Mir330 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO MIR330 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of MIR330 mRNA CTD PMID:30096437 Mir330 Rat 2,5-hexanedione increases expression EXP 6480464 2 and 5-hexanedione results in increased expression of MIR330 mRNA CTD PMID:31760062 Mir330 Rat atrazine decreases expression EXP 6480464 Atrazine results in decreased expression of MIR330 mRNA CTD PMID:31185338 Mir330 Rat benzo[a]pyrene increases methylation ISO MIR330 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of MIR330 promoter CTD PMID:27901495 Mir330 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Mir330 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of MIR330 mRNA CTD PMID:32105654 Mir330 Rat bleomycin A2 decreases expression EXP 6480464 Bleomycin results in decreased expression of MIR330 mRNA CTD PMID:25933445 Mir330 Rat cadmium atom multiple interactions ISO Mir330 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MIR330 mRNA CTD PMID:28892167 Mir330 Rat cadmium dichloride multiple interactions ISO Mir330 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MIR330 mRNA CTD PMID:28892167 Mir330 Rat dexmedetomidine multiple interactions EXP 6480464 Dexmedetomidine affects the reaction [MIR330 protein affects the expression of HSPD1 mRNA] more ... CTD PMID:34590382 Mir330 Rat formaldehyde decreases expression ISO MIR330 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of MIR330 mRNA CTD PMID:21147603 Mir330 Rat hydrogen peroxide increases expression ISO MIR330 (Homo sapiens) 6480464 Hydrogen Peroxide results in increased expression of MIR330 mRNA CTD PMID:26339600 Mir330 Rat lead diacetate increases expression ISO Mir330 (Mus musculus) 6480464 lead acetate results in increased expression of MIR330 mRNA CTD PMID:36183778 Mir330 Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of MIR330 mRNA CTD PMID:26720608 Mir330 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of MIR330 mRNA CTD PMID:22112502 Mir330 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of MIR330 mRNA CTD PMID:22112502 Mir330 Rat phenoxymethylpenicillin decreases expression EXP 6480464 Penicillin V results in decreased expression of MIR330 mRNA CTD PMID:22112502 Mir330 Rat PhIP decreases expression ISO MIR330 (Homo sapiens) 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in decreased expression of MIR330 mRNA CTD PMID:24877718 Mir330 Rat sevoflurane multiple interactions EXP 6480464 Dexmedetomidine inhibits the reaction [Sevoflurane results in increased expression of MIR330 mRNA] CTD PMID:34590382 Mir330 Rat sevoflurane increases expression EXP 6480464 Sevoflurane results in increased expression of MIR330 mRNA CTD PMID:34590382 Mir330 Rat sirolimus multiple interactions ISO MIR330 (Homo sapiens) 6480464 [(+)-JQ1 compound co-treated with Sirolimus] affects the expression of MIR330 mRNA CTD PMID:25307878 Mir330 Rat sodium arsenite increases expression ISO Mir330 (Mus musculus) 6480464 sodium arsenite results in increased expression of MIR330 mRNA CTD PMID:32068019 Mir330 Rat sodium arsenite increases expression ISO MIR330 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MIR330 mRNA CTD PMID:34032870 Mir330 Rat sodium fluoride increases expression ISO Mir330 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of MIR330 mRNA CTD PMID:29127033 Mir330 Rat streptozocin increases expression ISO Mir330 (Mus musculus) 6480464 Streptozocin results in increased expression of MIR330 mRNA CTD PMID:27629361 Mir330 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of MIR330 mRNA CTD PMID:22112502 Mir330 Rat titanium dioxide increases expression ISO Mir330 (Mus musculus) 6480464 titanium dioxide results in increased expression of MIR330 mRNA CTD PMID:29247641 Mir330 Rat trichloroethene decreases expression ISO Mir330 (Mus musculus) 6480464 Trichloroethylene results in decreased expression of MIR330 mRNA CTD PMID:32105654 Mir330 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of MIR330 mRNA CTD PMID:23869203 Mir330 Rat zinc atom decreases expression EXP 6480464 Zinc deficiency results in decreased expression of MIR330 mRNA CTD PMID:22689922 Mir330 Rat zinc(0) decreases expression EXP 6480464 Zinc deficiency results in decreased expression of MIR330 mRNA CTD PMID:22689922
1,3,5-trinitro-1,3,5-triazinane (ISO) 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,5-hexanedione (EXP) atrazine (EXP) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bleomycin A2 (EXP) cadmium atom (ISO) cadmium dichloride (ISO) dexmedetomidine (EXP) formaldehyde (ISO) hydrogen peroxide (ISO) lead diacetate (ISO) nitrofen (EXP) paracetamol (EXP) phenoxymethylpenicillin (EXP) PhIP (ISO) sevoflurane (EXP) sirolimus (ISO) sodium arsenite (ISO) sodium fluoride (ISO) streptozocin (ISO) tetrachloromethane (EXP) titanium dioxide (ISO) trichloroethene (ISO) vinclozolin (EXP) zinc atom (EXP) zinc(0) (EXP)
Mir330 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 87,961,207 - 87,961,303 (+) NCBI GRCr8 mRatBN7.2 1 78,833,178 - 78,833,274 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 78,833,178 - 78,833,274 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 84,222,262 - 84,222,358 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 92,779,863 - 92,779,959 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 85,977,353 - 85,977,449 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 80,092,681 - 80,092,777 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 80,092,681 - 80,092,777 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 81,358,760 - 81,358,856 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 1 73,298,803 - 73,298,899 (+) NCBI Celera Cytogenetic Map 1 q21 NCBI
MIR330 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 45,638,994 - 45,639,087 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 45,638,994 - 45,639,087 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 46,142,252 - 46,142,345 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 50,834,091 - 50,834,184 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 19 42,948,362 - 42,948,455 (-) NCBI Celera Cytogenetic Map 19 q13.32 NCBI HuRef 19 42,571,370 - 42,571,463 (-) NCBI HuRef CHM1_1 19 46,145,522 - 46,145,615 (-) NCBI CHM1_1 T2T-CHM13v2.0 19 48,466,260 - 48,466,353 (-) NCBI T2T-CHM13v2.0
Mir330 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 18,915,390 - 18,915,487 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 18,915,390 - 18,915,487 (+) Ensembl GRCm39 Ensembl GRCm38 7 19,181,465 - 19,181,562 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 19,181,465 - 19,181,562 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 19,766,814 - 19,766,911 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 7 16,593,315 - 16,593,412 (+) NCBI Celera Cytogenetic Map 7 A3 NCBI cM Map 7 9.46 NCBI
MIR330 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 109,922,138 - 109,922,226 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 109,922,124 - 109,922,231 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 109,407,206 - 109,407,294 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 110,455,335 - 110,455,423 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 1 110,130,892 - 110,130,980 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 109,765,521 - 109,765,609 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 110,634,432 - 110,634,520 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 17907 Count of gene targets: 8907 Count of transcripts: 9723 Interacting mature miRNAs: rno-miR-330-3p, rno-miR-330-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
2313059 Bss55 Bone structure and strength QTL 55 3.2 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1578649 Bmd8 Bone mineral density QTL 8 4.9 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 1 49393172 94393172 Rat 1582234 Gluco18 Glucose level QTL 18 3.4 0.0003 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 78479925 123479925 Rat 1358359 Sradr1 Stress Responsive Adrenal Weight QTL 1 4.74 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 30882023 123479925 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 4889929 Bss87 Bone structure and strength QTL 87 6.7 tibia area (VT:1000281) tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722) 1 53895117 82174945 Rat 2313062 Bmd73 Bone mineral density QTL 73 3.9 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 11481312 82174945 Rat 8552900 Pigfal1 Plasma insulin-like growth factor 1 level QTL 1 7.4 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1554320 Bmd1 Bone mineral density QTL 1 12.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 509108 86060548 Rat 2302059 Pia36 Pristane induced arthritis QTL 36 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 43333002 88333002 Rat 2313065 Bss67 Bone structure and strength QTL 67 3.1 0.0001 tibia area (VT:1000281) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 1300121 Hrtrt1 Heart rate QTL 1 3.7 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 65789093 115540829 Rat 7421628 Bp361 Blood pressure QTL 361 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 66023617 118608521 Rat 2313069 Bss68 Bone structure and strength QTL 68 2.9 0.0001 tibia size trait (VT:0100001) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 2313075 Bss66 Bone structure and strength QTL 66 3.4 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 11481312 82174945 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 631512 Scl6 Serum cholesterol level QTL 6 9.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 1 72197680 90508767 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 2313072 Bss53 Bone structure and strength QTL 53 4.3 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 43284731 118944897 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 2313078 Bss54 Bone structure and strength QTL 54 3.5 0.0001 tibia area (VT:1000281) tibia midshaft cross-sectional area (CMO:0001717) 1 43284731 118944897 Rat 2313077 Bss69 Bone structure and strength QTL 69 3.5 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 11481312 82174945 Rat 1549903 Bp267 Blood pressure QTL 267 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 77876254 106047988 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 61342 Bp27 Blood pressure QTL 27 3.4 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 56732668 98773277 Rat 1300172 Bp172 Blood pressure QTL 172 3.56 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 32737273 90665040 Rat 4889962 Bss94 Bone structure and strength QTL 94 3.8 tibia area (VT:1000281) tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722) 1 49361465 82174945 Rat 61344 Bp29 Blood pressure QTL 29 7.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 78350581 123350581 Rat 1358192 Ept13 Estrogen-induced pituitary tumorigenesis QTL 13 3.4 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 77494165 122494165 Rat 2313094 Bss58 Bone structure and strength QTL 58 3.7 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 43284731 118944897 Rat 6903308 Scl36 Serum cholesterol QTL 36 2 0.0125 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 53863041 90532583 Rat 2313092 Bmd72 Bone mineral density QTL 72 2.5 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 11481312 82174945 Rat 2300164 Bmd44 Bone mineral density QTL 44 5.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 1 56949932 101949932 Rat 2313099 Bss56 Bone structure and strength QTL 56 2.4 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 1 43284731 118944897 Rat 2313098 Bmd70 Bone mineral density QTL 70 3.6 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 43284731 118944897 Rat 2313097 Bss70 Bone structure and strength QTL 70 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 9589820 Insglur3 Insulin/glucose ratio QTL 3 10.75 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 1 34836858 79836858 Rat 152025249 Scl82 Serum cholesterol level QTL 82 4.77 blood cholesterol amount (VT:0000180) 1 50343510 99980958 Rat 10054135 Gmadr2 Adrenal mass QTL 2 1.97 0.0129 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 1 77857876 122857876 Rat 7411712 Strs4 Sensitivity to stroke QTL 4 8.7 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 1 78430536 123430536 Rat 4889919 Bss86 Bone structure and strength QTL 86 4.1 tibia area (VT:1000281) tibia midshaft total cross-sectional area (CMO:0001715) 1 53895117 82174945 Rat 8552948 Pigfal11 Plasma insulin-like growth factor 1 level QTL 11 4.7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 1 34836858 79836858 Rat 2313051 Bss57 Bone structure and strength QTL 57 3.7 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 43284731 118944897 Rat 61433 Cia2 Collagen induced arthritis QTL 2 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 78430754 91209302 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000053688
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 78,833,178 - 78,833,274 (+) Ensembl Rnor_6.0 Ensembl 1 80,092,681 - 80,092,777 (+) Ensembl
RefSeq Acc Id:
NR_031777
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 87,961,207 - 87,961,303 (+) NCBI mRatBN7.2 1 78,833,178 - 78,833,274 (+) NCBI Rnor_6.0 1 80,092,681 - 80,092,777 (+) NCBI Rnor_5.0 1 81,358,760 - 81,358,856 (+) NCBI Celera 1 73,298,803 - 73,298,899 (+) NCBI
Sequence:
ACCCTTTGGCGATCTCTGCCTCTCTGGGCCTGTGTCTTAGGCTCTTCAAGATCTAACGAGCAAAGCACAGGGCCTGCAGAGAGGTAGCGCTCTGCTC
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-08-14
Mir330
microRNA 330
Mir330
microRNA mir-330
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2010-06-02
Mir330
microRNA mir-330
Symbol and Name status set to provisional
70820 PROVISIONAL
