Mir330 (microRNA 330) - Rat Genome Database

Name: Mir330
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: Mir330 (microRNA 330) Rattus norvegicus

Analyze

Symbol:

Mir330

Name:

microRNA 330

RGD ID:

2325620

Description:

Predicted to act upstream of or within several processes, including cellular response to forskolin; juxtaglomerular apparatus development; and long-term synaptic potentiation. Orthologous to human MIR330 (microRNA 330); INTERACTS WITH 2,5-hexanedione; atrazine; bleomycin A2.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-330; rno-mir-330

RGD Orthologs

Human

Mouse

Dog

Alliance Orthologs

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	87,961,207 - 87,961,303 (+)	NCBI		GRCr8
mRatBN7.2	1	78,833,178 - 78,833,274 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	78,833,178 - 78,833,274 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	84,222,262 - 84,222,358 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	92,779,863 - 92,779,959 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	85,977,353 - 85,977,449 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	80,092,681 - 80,092,777 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	80,092,681 - 80,092,777 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	81,358,760 - 81,358,856 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	73,298,803 - 73,298,899 (+)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Acute Lung Injury (IEP)

Myocardial Reperfusion Injury (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (ISO)

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (ISO)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,5-hexanedione (EXP)

atrazine (EXP)

benzo[a]pyrene (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bleomycin A2 (EXP)

cadmium atom (ISO)

cadmium dichloride (ISO)

dexmedetomidine (EXP)

formaldehyde (ISO)

hydrogen peroxide (ISO)

lead diacetate (ISO)

nitrofen (EXP)

paracetamol (EXP)

phenoxymethylpenicillin (EXP)

PhIP (ISO)

sevoflurane (EXP)

sirolimus (ISO)

sodium arsenite (ISO)

sodium fluoride (ISO)

streptozocin (ISO)

tetrachloromethane (EXP)

titanium dioxide (ISO)

trichloroethene (ISO)

vinclozolin (EXP)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to forskolin (ISO)

juxtaglomerular apparatus development (ISO)

long-term synaptic potentiation (ISO)

negative regulation of gene expression (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
2.	miR-96 and miR-330 overexpressed and targeted AQP5 in lipopolysaccharide-induced rat lung damage of disseminated intravascular coagulation.	Zhang Y, etal., Blood Coagul Fibrinolysis. 2014 Oct;25(7):731-7. doi: 10.1097/MBC.0000000000000133.

Additional References at PubMed

PMID:14691248	PMID:16381832	PMID:17604727	PMID:20403161	PMID:21993888	PMID:25858512	PMID:30015907	PMID:32360974	PMID:33508876	PMID:35451738	PMID:36794530	PMID:37584866

Genomics

Comparative Map Data

Mir330
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	87,961,207 - 87,961,303 (+)	NCBI		GRCr8
mRatBN7.2	1	78,833,178 - 78,833,274 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	78,833,178 - 78,833,274 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	1	84,222,262 - 84,222,358 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	92,779,863 - 92,779,959 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	85,977,353 - 85,977,449 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	1	80,092,681 - 80,092,777 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	80,092,681 - 80,092,777 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	1	81,358,760 - 81,358,856 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	73,298,803 - 73,298,899 (+)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

MIR330
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	45,638,994 - 45,639,087 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	19	45,638,994 - 45,639,087 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	19	46,142,252 - 46,142,345 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	50,834,091 - 50,834,184 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	19	42,948,362 - 42,948,455 (-)	NCBI		Celera
Cytogenetic Map	19	q13.32	NCBI
HuRef	19	42,571,370 - 42,571,463 (-)	NCBI		HuRef
CHM1_1	19	46,145,522 - 46,145,615 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	19	48,466,260 - 48,466,353 (-)	NCBI		T2T-CHM13v2.0

Mir330
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	7	18,915,390 - 18,915,487 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	7	18,915,390 - 18,915,487 (+)	Ensembl		GRCm39 Ensembl
GRCm38	7	19,181,465 - 19,181,562 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	7	19,181,465 - 19,181,562 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	7	19,766,814 - 19,766,911 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	7	16,593,315 - 16,593,412 (+)	NCBI		Celera
Cytogenetic Map	7	A3	NCBI
cM Map	7	9.46	NCBI

MIR330
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	109,922,138 - 109,922,226 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	109,922,124 - 109,922,231 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	109,407,206 - 109,407,294 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	110,455,335 - 110,455,423 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	1	110,130,892 - 110,130,980 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	109,765,521 - 109,765,609 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	110,634,432 - 110,634,520 (+)	NCBI		UU_Cfam_GSD_1.0

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	17907
Count of gene targets:	8907
Count of transcripts:	9723
Interacting mature miRNAs:	rno-miR-330-3p, rno-miR-330-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2313059	Bss55	Bone structure and strength QTL 55	3.2	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	49393172	94393172	Rat
1582234	Gluco18	Glucose level QTL 18	3.4	0.0003	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	78479925	123479925	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	30882023	123479925	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
4889929	Bss87	Bone structure and strength QTL 87	6.7		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	53895117	82174945	Rat
2313062	Bmd73	Bone mineral density QTL 73	3.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	11481312	82174945	Rat
8552900	Pigfal1	Plasma insulin-like growth factor 1 level QTL 1	7.4		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	34836858	79836858	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
1554320	Bmd1	Bone mineral density QTL 1	12.2	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	509108	86060548	Rat
2302059	Pia36	Pristane induced arthritis QTL 36	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	43333002	88333002	Rat
2313065	Bss67	Bone structure and strength QTL 67	3.1	0.0001	tibia area (VT:1000281)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
1300121	Hrtrt1	Heart rate QTL 1	3.7		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	65789093	115540829	Rat
7421628	Bp361	Blood pressure QTL 361		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	66023617	118608521	Rat
2313069	Bss68	Bone structure and strength QTL 68	2.9	0.0001	tibia size trait (VT:0100001)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	22340647	102268831	Rat
2313075	Bss66	Bone structure and strength QTL 66	3.4	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	11481312	82174945	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
631512	Scl6	Serum cholesterol level QTL 6	9.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	1	72197680	90508767	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	57336763	151090257	Rat
2313072	Bss53	Bone structure and strength QTL 53	4.3	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	43284731	118944897	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
2313078	Bss54	Bone structure and strength QTL 54	3.5	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
2313077	Bss69	Bone structure and strength QTL 69	3.5	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	11481312	82174945	Rat
1549903	Bp267	Blood pressure QTL 267			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	77876254	106047988	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	48963584	144267916	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	56732668	98773277	Rat
1300172	Bp172	Blood pressure QTL 172	3.56		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	32737273	90665040	Rat
4889962	Bss94	Bone structure and strength QTL 94	3.8		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	49361465	82174945	Rat
61344	Bp29	Blood pressure QTL 29	7.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	78350581	123350581	Rat
1358192	Ept13	Estrogen-induced pituitary tumorigenesis QTL 13	3.4		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	77494165	122494165	Rat
2313094	Bss58	Bone structure and strength QTL 58	3.7	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	43284731	118944897	Rat
6903308	Scl36	Serum cholesterol QTL 36	2	0.0125	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	53863041	90532583	Rat
2313092	Bmd72	Bone mineral density QTL 72	2.5	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	11481312	82174945	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	56949932	101949932	Rat
2313099	Bss56	Bone structure and strength QTL 56	2.4	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	1	43284731	118944897	Rat
2313098	Bmd70	Bone mineral density QTL 70	3.6	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	43284731	118944897	Rat
2313097	Bss70	Bone structure and strength QTL 70	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
9589820	Insglur3	Insulin/glucose ratio QTL 3	10.75	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	1	34836858	79836858	Rat
152025249	Scl82	Serum cholesterol level QTL 82	4.77		blood cholesterol amount (VT:0000180)		1	50343510	99980958	Rat
10054135	Gmadr2	Adrenal mass QTL 2	1.97	0.0129	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	77857876	122857876	Rat
7411712	Strs4	Sensitivity to stroke QTL 4	8.7		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	1	78430536	123430536	Rat
4889919	Bss86	Bone structure and strength QTL 86	4.1		tibia area (VT:1000281)	tibia midshaft total cross-sectional area (CMO:0001715)	1	53895117	82174945	Rat
8552948	Pigfal11	Plasma insulin-like growth factor 1 level QTL 11	4.7		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	34836858	79836858	Rat
2313051	Bss57	Bone structure and strength QTL 57	3.7	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	43284731	118944897	Rat
61433	Cia2	Collagen induced arthritis QTL 2	5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	78430754	91209302	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	mesenchyme	mesoderm	nervous system	reproductive system	respiratory system
2	37	7	6	3	6	3	14	11	34	12	3

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031777	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000001	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000053688

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	1	78,833,178 - 78,833,274 (+)	Ensembl
Rnor_6.0 Ensembl	1	80,092,681 - 80,092,777 (+)	Ensembl

RefSeq Acc Id:

NR_031777

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	87,961,207 - 87,961,303 (+)	NCBI
mRatBN7.2	1	78,833,178 - 78,833,274 (+)	NCBI
Rnor_6.0	1	80,092,681 - 80,092,777 (+)	NCBI
Rnor_5.0	1	81,358,760 - 81,358,856 (+)	NCBI
Celera	1	73,298,803 - 73,298,899 (+)	NCBI

Sequence:

show sequence

ACCCTTTGGCGATCTCTGCCTCTCTGGGCCTGTGTCTTAGGCTCTTCAAGATCTAACGAGCAAA
GCACAGGGCCTGCAGAGAGGTAGCGCTCTGCTC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325620	AgrOrtholog
BioCyc Gene	G2FUF-60523	BioCyc
Ensembl Genes	ENSRNOG00000035565	Ensembl
miRBase	MI0000606	ENTREZGENE
NCBI Gene	100313974	ENTREZGENE
PhenoGen	Mir330	PhenoGen
RatGTEx	ENSRNOG00000035565	RatGTEx
RNAcentral	URS00003380C1	RNACentral
	URS00004CBBFA	RNACentral
	URS00006834ED	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir330	microRNA 330	Mir330	microRNA mir-330	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir330	microRNA mir-330			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD